mynn

Ensembl ID:
ENSDARG00000007271
ZFIN ID:
ZDB-GENE-030131-5378
Description:
Myoneurin [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVR6]
Human Orthologue:
MYNN
Human Description:
myoneurin [Source:HGNC Symbol;Acc:14955]
Mouse Orthologue:
Mynn
Mouse Description:
myoneurin Gene [Source:MGI Symbol;Acc:MGI:1931415]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17148 Nonsense Available for shipment Available now
sa32490 Nonsense Available for shipment Available now
sa17466 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17148
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003884 Nonsense 144 808 4 9
ENSDART00000145637   None 215 None 4
ENSDART00000145752 Nonsense 144 167 4 4
Genomic Location (Zv9):
Chromosome 24 (position 27129830)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26188187
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACAAGCGGAATAYGAGGATCCACGATCTCCTCTAAGCCCAGATGACTA[T/A]GAGYCTTTAGAGCCGATCTCGGAGGTGGARGAGCGAGAGCTGCTGCGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32490
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003884 Nonsense 455 808 4 9
ENSDART00000145637   None 215 None 4
ENSDART00000145752   None 167 None 4
Genomic Location (Zv9):
Chromosome 24 (position 27130763)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26189120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAGGAAGAGGAGATGGATGACGAGTTTGAGAATGATAATGAGGACTG[G/A]GCAGGGGAAGAGGAAGTGAAACCGGTGCAGGACAAACACAGGCCTATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17466
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003884 Nonsense 528 808 5 9
ENSDART00000145637   None 215 None 4
ENSDART00000145752   None 167 None 4
Genomic Location (Zv9):
Chromosome 24 (position 27133825)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26192182
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGAGTGATGCATGTTCTGTGCTGTTTTCAGGAGAGAAGYCCTTCACCTG[T/A]ACGTCCTGCGATKCKCGGTTTGCTCAGAAGTGTCAGCTGGTCTATCACTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Colorectal cancer: Meta-analysis of three genome-wide association studies identifies susceptibility loci for colorectal cancer at 1q41, 3q26.2, 12q13.13 and 20q13.33. (View Study)
  • Multiple sclerosis: Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link