mynn

Ensembl ID:
ENSDARG00000007271
ZFIN ID:
ZDB-GENE-030131-5378
Description:
Myoneurin [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVR6]
Human Orthologue:
MYNN
Human Description:
myoneurin [Source:HGNC Symbol;Acc:14955]
Mouse Orthologue:
Mynn
Mouse Description:
myoneurin Gene [Source:MGI Symbol;Acc:MGI:1931415]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17148 Nonsense Available for shipment Available now
sa17466 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17148
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003884 Nonsense 144 808 4 9
ENSDART00000145637 None None 215 None 4
ENSDART00000145752 Nonsense 144 167 4 4
Genomic Location:
Chromosome 24 (position 27129830)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACAAGCGGAATAYGAGGATCCACGATCTCCTCTAAGCCCAGATGACTA[T/A]GAGYCTTTAGAGCCGATCTCGGAGGTGGARGAGCGAGAGCTGCTGCGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17466
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003884 Nonsense 528 808 5 9
ENSDART00000145637 None None 215 None 4
ENSDART00000145752 None None 167 None 4
Genomic Location:
Chromosome 24 (position 27133825)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGAGTGATGCATGTTCTGTGCTGTTTTCAGGAGAGAAGYCCTTCACCTG[T/A]ACGTCCTGCGATKCKCGGTTTGCTCAGAAGTGTCAGCTGGTCTATCACTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Colorectal cancer: Meta-analysis of three genome-wide association studies identifies susceptibility loci for colorectal cancer at 1q41, 3q26.2, 12q13.13 and 20q13.33. (View Study)
  • Multiple sclerosis: Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y8lhm56t