LOC792554

Ensembl ID:
ENSDARG00000007265
Human Orthologue:
RGS13
Human Description:
regulator of G-protein signaling 13 [Source:HGNC Symbol;Acc:9995]
Mouse Orthologue:
Rgs13
Mouse Description:
regulator of G-protein signaling 13 Gene [Source:MGI Symbol;Acc:MGI:2180585]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43844 Nonsense Mutation detected in F1 DNA During 2016
sa43845 Nonsense Mutation detected in F1 DNA During 2016
sa13389 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa43844
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007901 Nonsense 48 183 3 5
Genomic Location:
Chromosome 22 (position 23540496)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTAATCCGGTCAACTAATCAAACCTGTCTGATCCCATCAGGCTAAGTT[T/A]AGAAGACACCCAACAATGGTCTCAGTCTCTGGAGCGACTCCTCGGGTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43845
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007901 Nonsense 53 183 3 5
Genomic Location:
Chromosome 22 (position 23540510)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTAATCAAACCTGTCTGATCCCATCAGGCTAAGTTTAGAAGACACCCAA[C/T]AATGGTCTCAGTCTCTGGAGCGACTCCTCGGGTCCAAATGTAAGGCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13389
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007901 Essential Splice Site 66 183 4 5
Genomic Location:
Chromosome 22 (position 23540631)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCACTGGWAAACTGGAACATAAATTAAAGAGGTGCTGTTTGCCTCCTCC[A/T]GRTGGCCTGGCAACTTTCCGCACCTTTCTGAAATCAGAGTTTAGCGATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link