LOC792554

Ensembl ID:
ENSDARG00000007265
Human Orthologue:
RGS13
Human Description:
regulator of G-protein signaling 13 [Source:HGNC Symbol;Acc:9995]
Mouse Orthologue:
Rgs13
Mouse Description:
regulator of G-protein signaling 13 Gene [Source:MGI Symbol;Acc:MGI:2180585]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13389 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13389
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007901 Essential Splice Site 66 183 4 5
Genomic Location:
Chromosome 22 (position 23540631)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCACTGGWAAACTGGAACATAAATTAAAGAGGTGCTGTTTGCCTCCTCC[A/T]GRTGGCCTGGCAACTTTCCGCACCTTTCTGAAATCAGAGTTTAGCGATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s4x89phr