gbas

Ensembl ID:
ENSDARG00000007264
ZFIN ID:
ZDB-GENE-991008-18
Description:
Protein NipSnap homolog 2 [Source:UniProtKB/Swiss-Prot;Acc:Q9PU58]
Human Orthologue:
GBAS
Human Description:
glioblastoma amplified sequence [Source:HGNC Symbol;Acc:4179]
Mouse Orthologue:
Gbas
Mouse Description:
glioblastoma amplified sequence Gene [Source:MGI Symbol;Acc:MGI:1278343]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44815 Nonsense Mutation detected in F1 DNA During 2017
sa24970 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44815
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122582 Nonsense 14 286 1 11
Genomic Location (Zv9):
Chromosome 15 (position 454648)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGGAAGATGGCGACCAGAGTCCTTCACAGCTCCTGCTCCGGCCTGTA[T/A]CGGGCTGCAGGACCGGCCCGGGGCAAAGGACACGCGACTGCCGTTATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24970
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122582 Essential Splice Site None 286 None 11
Genomic Location (Zv9):
Chromosome 15 (position 464225)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 504528
KASP Assay ID:
554-7840.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATATGATTCTGCTCTGATTATTGATGATGTTTTCTGTATGTGTGTGTG[T/A]GAGACGGCCGCATGCACACACACTCTACATTACGCCGCTCATCTGTTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link