ric8a

Ensembl ID:
ENSDARG00000007247
ZFIN ID:
ZDB-GENE-040927-18
Description:
Synembryn-A [Source:UniProtKB/Swiss-Prot;Acc:Q642H7]
Human Orthologue:
RIC8A
Human Description:
resistance to inhibitors of cholinesterase 8 homolog A (C. elegans) [Source:HGNC Symbol;Acc:29550]
Mouse Orthologue:
Ric8
Mouse Description:
resistance to inhibitors of cholinesterase 8 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:21

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15715 Nonsense Available for shipment Available now
sa24616 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15715
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044738 Nonsense 56 550 3 11
ENSDART00000125288 Nonsense 10 504 1 9
ENSDART00000130354 Nonsense 62 556 4 12
Genomic Location:
Chromosome 25 (position 10681452)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCNNGTTTTCTCATTTCTCAGCGTCTGGGTGAGTTAGTGKTAAGCTTTT[T/A]GRAGAGAGACCTCCAGCCRTCCTGCCAGCTGGCCTGCCTRGAGACCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24616
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044738 Nonsense 229 550 4 11
ENSDART00000125288 Nonsense 183 504 2 9
ENSDART00000130354 Nonsense 235 556 5 12
Genomic Location:
Chromosome 25 (position 10684436)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCGCGGGCTGGGTTCGACGGCTGCTCAGAGCTGCCCCCGCTGGGCAGA[C/T]AAGAGACCGAGAGAGTCATGGAGATCCTCAAGATCCTCTTCAATGTTACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Uterine fibroids: A genome-wide association study identifies three loci associated with susceptibility to uterine fibroids. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h10jlsxr