LOC100148117

Ensembl ID:
ENSDARG00000007245
Human Orthologue:
RUNDC3A
Human Description:
RUN domain containing 3A [Source:HGNC Symbol;Acc:16984]
Mouse Orthologue:
Rundc3a
Mouse Description:
RUN domain containing 3A Gene [Source:MGI Symbol;Acc:MGI:1858752]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13181 Nonsense Available for shipment Available now
sa40046 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13181
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002393 Nonsense 125 430 4 11
Genomic Location (Zv9):
Chromosome 3 (position 21113673)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 20873410
KASP Assay ID:
2259-3324.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAATGCACTCTTCTTGTCCTACAGGGACGAGCCTGGATTCGTGTAGCTT[T/A]AATGGAGAAGCGTTTATCTGAATATGTAGCCATCGCATTAAGAGACACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40046
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002393 Nonsense 249 430 7 11
Genomic Location (Zv9):
Chromosome 3 (position 21113032)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 20872769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCACAGACGAAGAAACCTGGAGTAACAAGTGCCGAAAGATGGAGCAA[C/T]GATTCAAGATTGTTAATGCTCAAAAGGTATCATAAATATCTGACAGGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link