LOC100148117

Ensembl ID:
ENSDARG00000007245
Human Orthologue:
RUNDC3A
Human Description:
RUN domain containing 3A [Source:HGNC Symbol;Acc:16984]
Mouse Orthologue:
Rundc3a
Mouse Description:
RUN domain containing 3A Gene [Source:MGI Symbol;Acc:MGI:1858752]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13181 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13181
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002393 Nonsense 125 430 4 11
Genomic Location:
Chromosome 3 (position 21113673)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAATGCACTCTTCTTGTCCTACAGGGACGAGCCTGGATTCGTGTAGCTT[T/A]AATGGAGAAGCGTTTATCTGAATATGTAGCCATCGCATTAAGAGACACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/txaosr5o