ACP2

Ensembl ID:
ENSDARG00000007244
Description:
acid phosphatase 2, lysosomal [Source:HGNC Symbol;Acc:123]
Human Orthologue:
ACP2
Human Description:
acid phosphatase 2, lysosomal [Source:HGNC Symbol;Acc:123]
Mouse Orthologue:
Acp2
Mouse Description:
acid phosphatase 2, lysosomal Gene [Source:MGI Symbol;Acc:MGI:87882]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21028 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13634 Nonsense Available for shipment Available now
sa21029 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21028
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022634 Essential Splice Site 56 411 2 14
Genomic Location:
Chromosome 7 (position 40756901)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCATACAAGGAGAGTGACTGGCCTCAGGGTTTTGGACAGCTCTCTCAGG[T/C]ATACACAAACACACATTCCATACCCTCTTTGTTTTTGTTTCATGCTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13634
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022634 Nonsense 150 411 5 14
Genomic Location:
Chromosome 7 (position 40759875)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTTTTCAGCTACTCTCATTCCCACTAGAWAACTGTCCAYGTTACAAA[C/T]AGCTCATGAATGAGACTGCAAAAACGGATGTTTTTCTCAACATGACTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21029
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022634 Essential Splice Site 309 411 9 14
Genomic Location:
Chromosome 7 (position 40763832)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACCTTATGCCTCATGTCATATGATTGAACTTTACCAGGAAGACAATGG[G/T]TAAAACATATATGCTCTATATTATCTTTATCAGCTTTTTCAGAAATTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/adqbh9n6