rest

Ensembl ID:
ENSDARG00000007222
ZFIN ID:
ZDB-GENE-080415-1
Description:
RE1-silencing transcription factor [Source:UniProtKB/Swiss-Prot;Acc:Q2EI20]
Human Orthologue:
REST
Human Description:
RE1-silencing transcription factor [Source:HGNC Symbol;Acc:9966]
Mouse Orthologue:
Rest
Mouse Description:
RE1-silencing transcription factor Gene [Source:MGI Symbol;Acc:MGI:104897]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35769 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35769
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018955 Nonsense 154 854 1 3
Genomic Location (Zv9):
Chromosome 14 (position 53551547)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 51712208
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAAAAACCTTTCTTCTGCAAACCCTGCCAGTATCAGGGTGAGAACGAG[C/T]AGGAGTTTATAGTGCACATACGCACGCACGGAGCCAAGAAGATGCTGGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link