pbk

Ensembl ID:
ENSDARG00000007221
ZFIN ID:
ZDB-GENE-030523-2
Description:
Lymphokine-activated killer T-cell-originated protein kinase homolog [Source:UniProtKB/Swiss-Prot;Ac
Human Orthologue:
PBK
Human Description:
PDZ binding kinase [Source:HGNC Symbol;Acc:18282]
Mouse Orthologue:
Pbk
Mouse Description:
PDZ binding kinase Gene [Source:MGI Symbol;Acc:MGI:1289156]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23782 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23782
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021788 Essential Splice Site 202 339 7 8
ENSDART00000136476   None 202 None 5
Genomic Location (Zv9):
Chromosome 20 (position 39386772)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39459184
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGCCTCTTCCACCTGTTTTGAGTGATCAAGTTAAGCTATCTTTCTTC[A/G]GTGAGTGATCCAAAGGCTCATTACATTGGGACGGAGCCGTGGAAGCCCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link