ncam1b

Ensembl ID:
ENSDARG00000007220
ZFIN ID:
ZDB-GENE-010822-2
Description:
neural cell adhesion molecule 1b [Source:RefSeq peptide;Acc:NP_571906]
Human Orthologue:
NCAM1
Human Description:
neural cell adhesion molecule 1 [Source:HGNC Symbol;Acc:7656]
Mouse Orthologue:
Ncam1
Mouse Description:
neural cell adhesion molecule 1 Gene [Source:MGI Symbol;Acc:MGI:97281]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35855 Nonsense Mutation detected in F1 DNA During 2017
sa35854 Essential Splice Site Available for shipment Available now
sa42522 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35855
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019006 Nonsense 279 1031 7 20
ENSDART00000101610 Nonsense 279 718 7 18
ENSDART00000136208   None 268 None 9
ENSDART00000142010 Nonsense 279 1031 7 21
ENSDART00000146853   None 270 None 7
Genomic Location (Zv9):
Chromosome 15 (position 17416139)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 18536512
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTCAGAGATGACAGTACTAGATGTGACAAAGCTGGACGAGGGAGATTA[C/A]ACATGCATTGCTAAGAACAAAGCTGGGGAGAGCGAACAAGAACTTAGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35854
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019006 Essential Splice Site 300 1031 8 20
ENSDART00000101610 Essential Splice Site 300 718 8 18
ENSDART00000136208   None 268 None 9
ENSDART00000142010 Essential Splice Site 300 1031 8 21
ENSDART00000146853   None 270 None 7
Genomic Location (Zv9):
Chromosome 15 (position 17413324)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 18533697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAATGACAGAAAGTCTCAGTGATCTAACCTTGTCTGTTTTGTTCTCTC[A/G]GTACAACCCAAAATCACATACTTGGAAAGCCAGACGACCACAGAAATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42522
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019006 Nonsense 542 1031 13 20
ENSDART00000101610 Nonsense 550 718 14 18
ENSDART00000136208 Nonsense 65 268 2 9
ENSDART00000142010 Nonsense 542 1031 13 21
ENSDART00000146853 Nonsense 91 270 3 7
Genomic Location (Zv9):
Chromosome 15 (position 17372660)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 18493033
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCCCGAGTCCACTGGAGGAGTTCCTGTGCTCAAGTACCGAGCCGAGT[G/A]GAGAGCCGTGGGCCGAGGGAAATGGGTGCAGCGAGTCTATGAGGTGAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link