abce1

Ensembl ID:
ENSDARG00000007216
ZFIN ID:
ZDB-GENE-040426-1995
Description:
ATP-binding cassette sub-family E member 1 isoform 1 [Source:RefSeq peptide;Acc:NP_998718]
Human Orthologue:
ABCE1
Human Description:
ATP-binding cassette, sub-family E (OABP), member 1 [Source:HGNC Symbol;Acc:69]
Mouse Orthologue:
Abce1
Mouse Description:
ATP-binding cassette, sub-family E (OABP), member 1 Gene [Source:MGI Symbol;Acc:MGI:1195458]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24410 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24410
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015777 Nonsense 52 599 3 18
Genomic Location:
Chromosome 23 (position 43881756)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAGCTGTGTATTGAAGTCTCACCTCAGAGTAAAATCGTTTGGATCTCA[G/T]AGTCTCTCTGCATCGGATGTGGAATCTGCATTAAGGTATTAAAGCAACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ahwlzcrk