rae1

Ensembl ID:
ENSDARG00000007196
ZFIN ID:
ZDB-GENE-040426-1029
Description:
mRNA export factor [Source:UniProtKB/Swiss-Prot;Acc:Q7ZWF0]
Human Orthologue:
RAE1
Human Description:
RAE1 RNA export 1 homolog (S. pombe) [Source:HGNC Symbol;Acc:9828]
Mouse Orthologue:
Rae1
Mouse Description:
RAE1 RNA export 1 homolog (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1913929]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2291 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2291
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020333 Essential Splice Site 126 368 6 13
ENSDART00000136979 Essential Splice Site 126 126 5 5

The following transcripts of ENSDARG00000007196 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 24012608)
KASP Assay ID:
554-2599.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACCTGTACTTTTTGTGTGTAATTTAATAGGTTCTACNATTTTTTTTTC[A/T]GCATGAAGGTCCAATCAGGACAATTCACTGGATTAAAGCACCAAACTACA
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control on top; Mutant below; 5 dpf

Control on top; Mutant below; 5 dpf

zoom

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
eye
ZFA:0000107
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
head
ZFA:0001114
malformed
PATO:0000646
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
liver
ZFA:0000123
hypoplastic
PATO:0000645
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
pancreas
ZFA:0000140
absent
PATO:0000462
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
yolk
ZFA:0000084
increased size
PATO:0000586
abnormal
PATO:0000460

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dau71zf2