grm7

Ensembl ID:
ENSDARG00000007195
Human Orthologue:
GRM2
Human Description:
glutamate receptor, metabotropic 2 [Source:HGNC Symbol;Acc:4594]
Mouse Orthologue:
Grm2
Mouse Description:
glutamate receptor, metabotropic 2 Gene [Source:MGI Symbol;Acc:MGI:1351339]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41884 Nonsense Mutation detected in F1 DNA During 2017
sa41885 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41884
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012940 Nonsense 253 874 2 5
Genomic Location (Zv9):
Chromosome 11 (position 37046688)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 35943916
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACGGCAAATCTGCATAGCAACTTCAGTAAAAGTCAGCCGCTCGGTGAAC[C/T]AAGGAAATTACGAAACAGTTATTCGATCACTTCAGCAGAAAGCCAACGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41885
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012940 Nonsense 425 874 2 5
Genomic Location (Zv9):
Chromosome 11 (position 37047206)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 35944434
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCACAAAAGTGTGTGACGCTATGAAGCCAGGCAATGGGAAAAGGTTCTA[C/A]CGGGAGTTTATTCTCAAGACTAAGTTTGATGGTGAGTAAAATTAGCAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link