ppp1r8

Ensembl ID:
ENSDARG00000007186
ZFIN ID:
ZDB-GENE-060503-681
Description:
hypothetical protein LOC566830 [Source:RefSeq peptide;Acc:NP_001094422]
Human Orthologue:
PPP1R8
Human Description:
protein phosphatase 1, regulatory (inhibitor) subunit 8 [Source:HGNC Symbol;Acc:9296]
Mouse Orthologue:
Ppp1r8
Mouse Description:
protein phosphatase 1, regulatory (inhibitor) subunit 8 Gene [Source:MGI Symbol;Acc:MGI:2140494]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16598 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16598
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003164 Essential Splice Site 37 351 2 7
Genomic Location (Zv9):
Chromosome 19 (position 14954477)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 15618081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCACCTGGACTTCATTTGGATGTGGTTAAAGGAGACAAATTAATAGAGG[T/A]AAGACGAATTAACANNNNNNTTAAATAAAYAGTGATGAATRTTGTTGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link