recql

Ensembl ID:
ENSDARG00000007175
ZFIN ID:
ZDB-GENE-050809-134
Description:
ATP-dependent DNA helicase Q1 [Source:RefSeq peptide;Acc:NP_001038561]
Human Orthologue:
RECQL
Human Description:
RecQ protein-like (DNA helicase Q1-like) [Source:HGNC Symbol;Acc:9948]
Mouse Orthologue:
Recql
Mouse Description:
RecQ protein-like Gene [Source:MGI Symbol;Acc:MGI:103021]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40266 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33444 Nonsense Mutation detected in F1 DNA During 2017
sa33445 Nonsense Mutation detected in F1 DNA During 2017
sa33446 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40266
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021610 Essential Splice Site None 639 1 16
ENSDART00000101198 Essential Splice Site None 640 1 16
Genomic Location (Zv9):
Chromosome 4 (position 16592794)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 17535634
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGGCAAACAAGAGAAAGTGGAAGGAAGCTGGTTTAGGATCATTCAGCG[G/A]TGAGTTTGCTGAATTGCGTTTTCATACAATTCATTCGATATTCATAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33444
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021610 Nonsense 46 639 3 16
ENSDART00000101198 Nonsense 46 640 3 16
Genomic Location (Zv9):
Chromosome 4 (position 16594027)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 17536867
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGAAACAGACGAGGCTAAACTCCAGGAAGAACAAACTACTGAAGGTCT[T/A]GGAGGGAGCATGCAGCTCAGCCCAGCCTTCCGGATCCGGCAAAACTCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33445
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021610 Nonsense 103 639 4 16
ENSDART00000101198 Nonsense 103 640 4 16
Genomic Location (Zv9):
Chromosome 4 (position 16594977)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 17537817
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGAATCTATGTAACATATTCCAGCTTTCCAAATTTCGCCCTCTGCAA[C/T]GAGCGGCCATCAATCTGAGCATGTCAGGGAAAGATCTTTTCCTGGTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33446
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021610 Essential Splice Site 137 639 4 16
ENSDART00000101198 Essential Splice Site 137 640 4 16
Genomic Location (Zv9):
Chromosome 4 (position 16595083)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 17537923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTCGAGGAAAAAGCTTATGTTACCAGCTGCCAGCCCTCTGCTCTAAAG[G/T]TATGGGCTTGAATACTTCTATGTTGTTAAATTAGACATACTTTGAATGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link