plxna3

Ensembl ID:
ENSDARG00000007172
ZFIN ID:
ZDB-GENE-070613-1
Description:
plexin-A3 [Source:RefSeq peptide;Acc:NP_001091959]
Human Orthologue:
PLXNA3
Human Description:
plexin A3 [Source:HGNC Symbol;Acc:9101]
Mouse Orthologue:
Plxna3
Mouse Description:
plexin A3 Gene [Source:MGI Symbol;Acc:MGI:107683]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10020 Nonsense Available for shipment Available now
sa34310 Nonsense Mutation detected in F1 DNA During 2017
sa34309 Essential Splice Site Available for shipment Available now
sa41125 Nonsense Mutation detected in F1 DNA During 2017
sa34308 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa10020
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044000 Nonsense 313 1892 2 32
ENSDART00000079699 Nonsense 313 1892 1 31
Genomic Location (Zv9):
Chromosome 8 (position 10087560)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 9504142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGGRTGCACCAAGGATGGCGTGGAATACAGACTTGTTCAAGCKGCCTA[C/A]AARCATCGTCCTGGAAAGATTCTGGCACAGGCTTTGGGCCTGTCTGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34310
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044000 Nonsense 531 1892 5 32
ENSDART00000079699 Nonsense 531 1892 4 31
Genomic Location (Zv9):
Chromosome 8 (position 9974524)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 9391106
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGCAGCTGTAAGACGTGTCTGGGCTCTGGAGATCCTCACTGCGGCTG[G/A]TGTGTCCTGCATAACAAGTGAGTCAATGTCATGCCTTTTACAATCACTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34309
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044000 Essential Splice Site 1342 1892 21 32
ENSDART00000079699 Essential Splice Site 1342 1892 20 31
Genomic Location (Zv9):
Chromosome 8 (position 9803805)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 9220387
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTGATGTTCCCTGGCATCGAGGAGCACCCGGTTCTGAAGGAGCTGGAC[G/A]TAAGGGAACTTTTAAAACTCTCTGTGCCCAGGTGGCGTCTGTCACTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41125
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044000 Nonsense 1556 1892 26 32
ENSDART00000079699 Nonsense 1556 1892 25 31
Genomic Location (Zv9):
Chromosome 8 (position 9779689)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 9196271
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATTTTAATCCCAGACTGATTCATTGATTGTCCTCCAACAGAATGGCGG[C/T]AGGGTCGACTGACCAGAATCATCCTCCAAGATGAAGACGTCACCACAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34308
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044000 Essential Splice Site 1861 1892 31 32
ENSDART00000079699 Essential Splice Site 1861 1892 30 31
Genomic Location (Zv9):
Chromosome 8 (position 9770932)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 9187514
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCGCGCTCAGTGAACTGTATTTCTACATCAACAAGTACAAAGAAGAGG[T/C]GAGACCTGCGGCTGCGTTTCACATCCAATCCTGAACACCACACTTTTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link