nadl1.2

Ensembl ID:
ENSDARG00000007149
ZFIN ID:
ZDB-GENE-990415-10
Description:
Neural cell adhesion molecule L1.2 [Source:UniProtKB/Swiss-Prot;Acc:Q90479]
Human Orthologue:
L1CAM
Human Description:
L1 cell adhesion molecule [Source:HGNC Symbol;Acc:6470]
Mouse Orthologue:
L1cam
Mouse Description:
L1 cell adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:96721]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24359 Nonsense Available for shipment Available now
sa37742 Essential Splice Site Available for shipment Available now
sa32448 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24359
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020296 Nonsense 15 1271 2 29
ENSDART00000103723 Nonsense 15 1272 1 27
ENSDART00000103731 Nonsense 15 1273 2 29
Genomic Location (Zv9):
Chromosome 23 (position 28891837)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28722404
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTGCAATGCCTGCCACGTCACAAAAACAGCAGGTGAGCAGCAGGGGG[C/T]GATGCACGGCTCTCCTGCTTCCTCTCCTTCTGCTAGCAGTGGCTCTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37742
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020296 Essential Splice Site 474 1271 12 29
ENSDART00000103723 Essential Splice Site 475 1272 11 27
ENSDART00000103731 Essential Splice Site 476 1273 12 29
Genomic Location (Zv9):
Chromosome 23 (position 28909842)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28740409
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGAATTGGCTTGCGAGACCTTTGGATCTCCTCGGCCCAATGTCACATG[G/A]TGAGACAGACTGGATCCTGTAGGGAGTCCTTTCCTCACATGCCAGAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32448
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020296 Nonsense 969 1271 22 29
ENSDART00000103723 Nonsense 970 1272 21 27
ENSDART00000103731 Nonsense 971 1273 22 29
Genomic Location (Zv9):
Chromosome 23 (position 28918123)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28748690
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCGCCCAACCAGCCAAATGGAAACCTGATTGGATACATCTTACAGCAT[C/T]AACAACGTGCGTTCATTCATTCTTCCCAGAAGAATTATGAGTAGTGAACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link