psmc3

Ensembl ID:
ENSDARG00000007141
ZFIN ID:
ZDB-GENE-030131-666
Description:
26S protease regulatory subunit 6A [Source:RefSeq peptide;Acc:NP_001002064]
Human Orthologue:
PSMC3
Human Description:
proteasome (prosome, macropain) 26S subunit, ATPase, 3 [Source:HGNC Symbol;Acc:9549]
Mouse Orthologue:
Psmc3
Mouse Description:
proteasome (prosome, macropain) 26S subunit, ATPase 3 Gene [Source:MGI Symbol;Acc:MGI:1098754]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40961 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40961
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007913 Essential Splice Site 210 404 7 11
ENSDART00000133705 Essential Splice Site 233 427 7 11
Genomic Location (Zv9):
Chromosome 7 (position 40075609)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38412249
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCACAGGAAAGACCCTGCTGGCCAGAGCCTGTGCAGCCCAAACCAAG[G/A]TCAGAGAGAACTGACGATCATCAAAATAACACTGTTGTCAACAATGTTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link