si:ch211-225n7.1

Ensembl ID:
ENSDARG00000007136
ZFIN ID:
ZDB-GENE-060503-310
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LWR2]
Human Orthologue:
SH3BP5L
Human Description:
SH3-binding domain protein 5-like [Source:HGNC Symbol;Acc:29360]
Mouse Orthologue:
Sh3bp5l
Mouse Description:
SH3 binding domain protein 5 like Gene [Source:MGI Symbol;Acc:MGI:1933124]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5925 Nonsense Mutation detected in F1 DNA During 2017
sa32246 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5925
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037169 Nonsense 217 301 5 7
ENSDART00000141203 Nonsense 172 420 5 6
Genomic Location (Zv9):
Chromosome 19 (position 27775961)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27706073
KASP Assay ID:
554-3666.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTGAAYGAGGCGGAGGAAGAGCGTTTGAGGAGCGAGAGGGAGCACCAG[C/T]GAGTCACTCAGCTTTGTCAAGAAGCAGAAGCGCGCGTGCAAACCTTRCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32246
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037169   None 301 None 7
ENSDART00000141203 Nonsense 250 420 6 6
Genomic Location (Zv9):
Chromosome 19 (position 27773222)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27703334
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCAGTTGCCCTCCGCAACCTCGAGCAAATCAGTGAGCAGATCCATGCG[C/T]AAAGGGGGCGCATCCGGGCCGCCAGAGAGCGCAACCGAGCCCGGGGTGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link