acat2

Ensembl ID:
ENSDARG00000007127
ZFIN ID:
ZDB-GENE-990714-22
Description:
acetyl-CoA acetyltransferase, cytosolic [Source:RefSeq peptide;Acc:NP_571445]
Human Orthologue:
ACAT2
Human Description:
acetyl-CoA acetyltransferase 2 [Source:HGNC Symbol;Acc:94]
Mouse Orthologues:
Acat2, Acat3
Mouse Descriptions:
acetyl-Coenzyme A acetyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:87871]
acetyl-Coenzyme A acetyltransferase 3 Gene [Source:MGI Symbol;Acc:MGI:109182]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32299 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32299
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006778 Nonsense 358 395 9 9
ENSDART00000062541   None 190 8 8
ENSDART00000146376   None 190 None 5
Genomic Location (Zv9):
Chromosome 20 (position 30949290)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31020503
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGGCGGAGCGATCTCTCTTGGTCATCCTCTTGGCATGTCCGGCTG[T/A]CGTGTGTTGGTGACTCTTCTTCATGCTCTTCAGAGGACAGGCGGACGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link