acat2

Ensembl ID:
ENSDARG00000007127
ZFIN ID:
ZDB-GENE-990714-22
Description:
acetyl-CoA acetyltransferase, cytosolic [Source:RefSeq peptide;Acc:NP_571445]
Human Orthologue:
ACAT2
Human Description:
acetyl-CoA acetyltransferase 2 [Source:HGNC Symbol;Acc:94]
Mouse Orthologues:
Acat2, Acat3
Mouse Descriptions:
acetyl-Coenzyme A acetyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:87871]
acetyl-Coenzyme A acetyltransferase 3 Gene [Source:MGI Symbol;Acc:MGI:109182]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4910 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4910
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006778 Essential Splice Site 302 395 None 9
ENSDART00000062541 Essential Splice Site None 190 None 8
ENSDART00000146376 None None 190 None 5
Genomic Location:
Chromosome 20 (position 30951819)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACCCTTCAGTCATGGGCACAGGGCCAATACCAGCTATTAGAAAAGCTG[T/A]GAGTGTCTGTTGAGTCATCRCAAGGTTTAATTYAAGAACACRAATGAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uv77kaf4