itm2ba

Ensembl ID:
ENSDARG00000007098
ZFIN ID:
ZDB-GENE-030131-2352
Description:
integral membrane protein 2B [Source:RefSeq peptide;Acc:NP_955940]
Human Orthologue:
ITM2B
Human Description:
integral membrane protein 2B [Source:HGNC Symbol;Acc:6174]
Mouse Orthologue:
Itm2b
Mouse Description:
integral membrane protein 2B Gene [Source:MGI Symbol;Acc:MGI:1309517]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10613 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10613
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028008 Nonsense 39 261 2 6
Genomic Location:
Chromosome 6 (position 9932929)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCTTTCCTTCTGTGTGTGCAGGATGTGGAGGACGTGCTGCGTGTCAGA[C/T]AGCAGTCCAGGGCTTGGTGCTGGTGCATGTGTTTGGGTTTGGCCTTGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xh2xsefj