her13

Ensembl ID:
ENSDARG00000007097
ZFIN ID:
ZDB-GENE-050228-1
Description:
hairy-related 13 [Source:RefSeq peptide;Acc:NP_001017901]
Human Orthologue:
HES6
Human Description:
hairy and enhancer of split 6 (Drosophila) [Source:HGNC Symbol;Acc:18254]
Mouse Orthologue:
Hes6
Mouse Description:
hairy and enhancer of split 6 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1859852]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42489 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42489
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109394 Nonsense 25 224 1 4
Genomic Location (Zv9):
Chromosome 15 (position 7114999)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 7190568
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACAATCTTGGTGTTGGGGAATATGCATGTTATGGATTTAAAGGTGAC[A/T]GAAAGGTAAGAAAATATTGCATTGTCTTAAATGTCAAAAAGGAATGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link