xab2

Ensembl ID:
ENSDARG00000007092
ZFIN ID:
ZDB-GENE-040426-685
Description:
pre-mRNA-splicing factor SYF1 [Source:RefSeq peptide;Acc:NP_001038248]
Human Orthologue:
XAB2
Human Description:
XPA binding protein 2 [Source:HGNC Symbol;Acc:14089]
Mouse Orthologue:
Xab2
Mouse Description:
XPA binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1914689]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40167 Nonsense Mutation detected in F1 DNA During 2016
sa33316 Nonsense Mutation detected in F1 DNA During 2016
sa33317 Nonsense Mutation detected in F1 DNA During 2016
sa14562 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa40167
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011780 Nonsense 139 851 4 19
Genomic Location (Zv9):
Chromosome 3 (position 53963682)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53070997
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGGAGCAGACGGACATTCGATAGAGCATTAAGAGCTCTGCCCATCACC[C/T]AGCATCCTCGCATCTGGCCTTTGTATCTTCGCTTTGCCCGGAACCTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33316
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011780 Nonsense 256 851 6 19
Genomic Location (Zv9):
Chromosome 3 (position 53967113)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53074428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGGAGGCCTCACTCGCTTCACTGACCAGCTGGGCAAACTCTGGTGCT[C/A]AATGGCCGATTACTACATCCGCAGTGGCCACTTCGAGAAGGTAAACCACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33317
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011780 Nonsense 296 851 7 19
Genomic Location (Zv9):
Chromosome 3 (position 53967592)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53074907
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACAGTTGTGACCGTGCGAGACTTCACCCAAGTTTTCGACAGCTACGCG[C/T]AGTTTGAGGAGAGCATGATCGCTGCCAAAATGGAGACCACATCTGAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14562
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011780 Essential Splice Site 831 851 18 19
Genomic Location (Zv9):
Chromosome 3 (position 53985060)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53092375
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YGATGATGATGATNNNNNNGATGAGGATGCGGAGGAYGCSGAGCCAGAGG[G/T]TTAGTTTTTATGAGAYTGGKGGTGTKATGGTGGASTAATTCGTATTAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link