aqp10a

Ensembl ID:
ENSDARG00000007086
ZFIN ID:
ZDB-GENE-040718-40
Description:
aquaporin 10a [Source:RefSeq peptide;Acc:NP_001002349]
Human Orthologue:
AQP10
Human Description:
aquaporin 10 [Source:HGNC Symbol;Acc:16029]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17940 Nonsense Available for shipment Available now
sa14632 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17940
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124718 Nonsense 100 300 3 6
Genomic Location:
Chromosome 16 (position 24472452)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAGTTTCTGTGTATTGGGAGACCTGGCCTGGATAAAGCTGCTACCRTA[T/A]TCTYTCGCYCAAATTTTAGGGGCTTACCTTGCTTYAGGGCTTGTCTATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14632
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124718 Nonsense 280 300 6 6
Genomic Location:
Chromosome 16 (position 24469610)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCATCTGCCTGAGCTTGAAGATGAATCTGAATCTGRGGAGATGAATGAT[C/T]AAACAAAARTCATGGAGCACAACAACAAAAAAGATGAGATATACCTTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/44ldhx33