pias4a

Ensembl ID:
ENSDARG00000007081
ZFIN ID:
ZDB-GENE-040426-2734
Description:
E3 SUMO-protein ligase PIAS4 [Source:RefSeq peptide;Acc:NP_998568]
Human Orthologue:
PIAS4
Human Description:
protein inhibitor of activated STAT, 4 [Source:HGNC Symbol;Acc:17002]
Mouse Orthologue:
Pias4
Mouse Description:
protein inhibitor of activated STAT 4 Gene [Source:MGI Symbol;Acc:MGI:2136940]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24157 Essential Splice Site Available for shipment Available now
sa18392 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24157
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105520 Essential Splice Site 168 508 4 11
Genomic Location (Zv9):
Chromosome 22 (position 20734620)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20389296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGACAAATGAAAACACGTTTGCACTCAACCATTTGTTTTATGTGTACA[G/A]TGAACTACGGCCAGGGATGAAATCAGTTCAGGTCGTTCTCAGGTAAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18392
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105520 Nonsense 196 508 5 11
Genomic Location (Zv9):
Chromosome 22 (position 20734446)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20389122
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCCCAGAATTTGCTACACAGACTCTATCGGCGTTCAGGAGGACCAGTA[T/A]CCTCCCAATATTGCWGTGAAAGTGAATCAGTCCTACTGTCATGTACCGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link