rhcgl1

Ensembl ID:
ENSDARG00000007080
ZFIN ID:
ZDB-GENE-060209-2
Description:
Rh type C glycoprotein2a [Source:RefSeq peptide;Acc:NP_001096088]
Human Orthologue:
RHCG
Human Description:
Rh family, C glycoprotein [Source:HGNC Symbol;Acc:18140]
Mouse Orthologue:
Rhcg
Mouse Description:
Rhesus blood group-associated C glycoprotein Gene [Source:MGI Symbol;Acc:MGI:1888517]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20745 Essential Splice Site Available for shipment Available now
sa40732 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20745
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004727 Essential Splice Site 178 471 4 11
Genomic Location (Zv9):
Chromosome 6 (position 36162886)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 36406420
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTCAAAGAATAACTTTTAAAGCTGAAATGGTGCATTTTGAATGCTTTC[A/G]GGTGAGAGATGCTGGTGGTTCTATGGTCATCCACACCTTTGGTGCATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40732
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004727 Essential Splice Site 283 471 6 11
Genomic Location (Zv9):
Chromosome 6 (position 36164799)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 36408333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTTAATCTTTTTTTGTGCTTAAAAATAACCTTTTCTTGCCATTGTTC[A/G]GGTACATATTCAGAATGCTACCTTGGCTGGTGGTGTAGCGATGGGAACGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link