si:dkey-145p14.5

Ensembl ID:
ENSDARG00000007077
ZFIN ID:
ZDB-GENE-041008-117
Description:
Si:dkey-145p14.5 protein [Source:UniProtKB/TrEMBL;Acc:Q5BJ03]
Human Orthologue:
ANKRD50
Human Description:
ankyrin repeat domain 50 [Source:HGNC Symbol;Acc:29223]
Mouse Orthologues:
Ankrd50, E230028L10Rik
Mouse Descriptions:
ankyrin repeat domain 50 Gene [Source:MGI Symbol;Acc:MGI:2139777]
RIKEN cDNA E230028L10 gene Gene [Source:MGI Symbol;Acc:MGI:2685285]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21520 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21520
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020798 Nonsense 239 537 1 2
ENSDART00000121751   None 322 None 5
Genomic Location (Zv9):
Chromosome 9 (position 33906712)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33062658
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAACAAAGTCATTTCACAATTGTCAGACTTCTGGAGAGCTATGGCGCC[A/T]AACCCTTCTCAGGTTTAATACCATTCACACCTAGTGGTGCTCCTAATGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link