sc:d157

Ensembl ID:
ENSDARG00000007040
ZFIN IDs:
ZDB-GENE-080303-20, ZDB-GENE-080303-6
Description:
hypothetical protein LOC559127 [Source:RefSeq peptide;Acc:NP_001091718]
Human Orthologue:
TMIGD1
Human Description:
transmembrane and immunoglobulin domain containing 1 [Source:HGNC Symbol;Acc:32431]
Mouse Orthologue:
Tmigd1
Mouse Description:
transmembrane and immunoglobulin domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1913851]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5961 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5961
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024407 Nonsense 62 251 2 5
Genomic Location (Zv9):
Chromosome 21 (position 38765073)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39905304
KASP Assay ID:
554-3807.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCACTTGTATGACTGATAATACTGACCCATCMAGCCAACAAGAGCTG[C/T]AGTGRTTCCGCAACGGTGCCCGTGTGAAACTGCCAGAAGAAAACATGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link