ENSDARG00000006983

Ensembl ID:
ENSDARG00000006983
Human Orthologue:
CELF3
Human Description:
CUGBP, Elav-like family member 3 [Source:HGNC Symbol;Acc:11967]
Mouse Orthologue:
Celf3
Mouse Description:
VCUGBP, Elav-like family member 3 Gene [Source:MGI Symbol;Acc:MGI:1926034]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42639 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42639
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024206 Nonsense 35 442 1 15
Genomic Location (Zv9):
Chromosome 16 (position 1357425)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 1306632
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGGAAAAGGACCTGAAGCCCATATTCGAGCAGTACGGCAAGATCTAC[G/T]AGCTGACTGTGATCAAGGACAAGTACACGGGCATGCACAAAGGTAAAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link