msxd

Ensembl ID:: ENSDARG00000006982
ZFIN ID:: ZDB-GENE-980526-492
Description:: Homeobox protein MSH-D [Source:UniProtKB/Swiss-Prot;Acc:Q01704]
Human Orthologues:: MSX1, MSX2
Human Descriptions:: msh homeobox 1 [Source:HGNC Symbol;Acc:7391]; msh homeobox 2 [Source:HGNC Symbol;Acc:7392]
Mouse Orthologues:: Msx1, Msx2
Mouse Descriptions:: homeobox, msh-like 1 Gene [Source:MGI Symbol;Acc:MGI:97168]; homeobox, msh-like 2 Gene [Source:MGI Symbol;Acc:MGI:97169]

Alleles

There is 1 allele of this gene:

Allele name	Consequence	Status	Availability Estimate
sa935	Nonsense	F2 line generated	During 2015

Mutation Details

Allele Name:: sa935
Current Status:: F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000003441	Nonsense	92	226	2	2
ENSDART00000123722	Nonsense	117	251	3	3

Genomic Location:: Chromosome 21 (position 40053335)
KASP Assay ID:: 554-0840.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: GNNNNTTTTTTTTTTAAAAATATATATATTTCCTACAGGCCAGGAAAGTCCCTG[T/A]CCTCTCCGCAAGCACAAGACCAATCGCAAACCCCGTACACCATTCACAAC
Associated Phenotype:: Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Electrocardiographic conduction measures: Genome-wide association study of electrocardiographic conduction measures in an isolated founder population: Kosrae. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

More OMIM information for MSX2

More OMIM information for MSX1

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: