msxd

Ensembl ID:
ENSDARG00000006982
ZFIN ID:
ZDB-GENE-980526-492
Description:
Homeobox protein MSH-D [Source:UniProtKB/Swiss-Prot;Acc:Q01704]
Human Orthologues:
MSX1, MSX2
Human Descriptions:
msh homeobox 1 [Source:HGNC Symbol;Acc:7391]
msh homeobox 2 [Source:HGNC Symbol;Acc:7392]
Mouse Orthologues:
Msx1, Msx2
Mouse Descriptions:
homeobox, msh-like 1 Gene [Source:MGI Symbol;Acc:MGI:97168]
homeobox, msh-like 2 Gene [Source:MGI Symbol;Acc:MGI:97169]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa935 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa935
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003441 Nonsense 92 226 2 2
ENSDART00000123722 Nonsense 117 251 3 3
Genomic Location:
Chromosome 21 (position 40053335)
KASP Assay ID:
554-0840.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GNNNNTTTTTTTTTTAAAAATATATATATTTCCTACAGGCCAGGAAAGTCCCTG[T/A]CCTCTCCGCAAGCACAAGACCAATCGCAAACCCCGTACACCATTCACAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mzxpmice