
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
msxd
- Ensembl ID:
- ENSDARG00000006982
- ZFIN ID:
- ZDB-GENE-980526-492
- Description:
- Homeobox protein MSH-D [Source:UniProtKB/Swiss-Prot;Acc:Q01704]
- Human Orthologues:
- MSX1, MSX2
- Human Descriptions:
- msh homeobox 1 [Source:HGNC Symbol;Acc:7391]
- msh homeobox 2 [Source:HGNC Symbol;Acc:7392]
- Mouse Orthologues:
- Msx1, Msx2
- Mouse Descriptions:
- homeobox, msh-like 1 Gene [Source:MGI Symbol;Acc:MGI:97168]
- homeobox, msh-like 2 Gene [Source:MGI Symbol;Acc:MGI:97169]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa935 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa935
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000003441 | Nonsense | 92 | 226 | 2 | 2 |
ENSDART00000123722 | Nonsense | 117 | 251 | 3 | 3 |
- Genomic Location (Zv9):
- Chromosome 21 (position 40053335)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 41285051 GRCz11 21 41145858 - KASP Assay ID:
- 554-0840.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GNNNNTTTTTTTTTTAAAAATATATATATTTCCTACAGGCCAGGAAAGTCCCTG[T/A]CCTCTCCGCAAGCACAAGACCAATCGCAAACCCCGTACACCATTCACAAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Electrocardiographic conduction measures: Genome-wide association study of electrocardiographic conduction measures in an isolated founder population: Kosrae. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: