ccdc113

Ensembl ID:
ENSDARG00000006981
ZFIN ID:
ZDB-GENE-041010-163
Description:
Coiled-coil domain-containing protein 113 [Source:UniProtKB/Swiss-Prot;Acc:Q5XJN6]
Human Orthologue:
CCDC113
Human Description:
coiled-coil domain containing 113 [Source:HGNC Symbol;Acc:25002]
Mouse Orthologue:
Ccdc113
Mouse Description:
coiled-coil domain containing 113 Gene [Source:MGI Symbol;Acc:MGI:3606076]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44254 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38025 Nonsense Mutation detected in F1 DNA During 2016
sa3322 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa44254
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008989 Essential Splice Site 63 358 2 8
Genomic Location:
Chromosome 25 (position 14095042)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGACGTTTGAAACAGTGTGGAAATGGCAGAATTTGTCAACGGAAAAGG[T/G]ACGTATTTGTGTTTAACGTTAATAAGATAAACAAGTGTGTACAGTTCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38025
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008989 Nonsense 172 358 5 8
Genomic Location:
Chromosome 25 (position 14097417)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTAAAAATCACAACGTAGTATCCAAATCTTTCCAGGACATTTTGATT[G/T]AGAAGTTGCACCGAAAAAATTCAGCACTCCTCACACACAAGAAAAAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3322
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008989 Essential Splice Site 335 358 8 8
Genomic Location:
Chromosome 25 (position 14100124)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATACATGTTTGTTTGTTTNTTTTTAATGTTCAAATTCTTGCATTATTTCC[A/T]GATGGCATTAAAAACCTACACAAAATCCTGGGAAAAGCTTCGATTTGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link