ccdc113

Ensembl ID:
ENSDARG00000006981
ZFIN ID:
ZDB-GENE-041010-163
Description:
Coiled-coil domain-containing protein 113 [Source:UniProtKB/Swiss-Prot;Acc:Q5XJN6]
Human Orthologue:
CCDC113
Human Description:
coiled-coil domain containing 113 [Source:HGNC Symbol;Acc:25002]
Mouse Orthologue:
Ccdc113
Mouse Description:
coiled-coil domain containing 113 Gene [Source:MGI Symbol;Acc:MGI:3606076]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3322 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3322
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008989 Essential Splice Site 335 358 8 8
Genomic Location:
Chromosome 25 (position 14100124)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATACATGTTTGTTTGTTTNTTTTTAATGTTCAAATTCTTGCATTATTTCC[A/T]GATGGCATTAAAAACCTACACAAAATCCTGGGAAAAGCTTCGATTTGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0tndjg9w