ccdc113

Ensembl ID:
ENSDARG00000006981
ZFIN ID:
ZDB-GENE-041010-163
Description:
Coiled-coil domain-containing protein 113 [Source:UniProtKB/Swiss-Prot;Acc:Q5XJN6]
Human Orthologue:
CCDC113
Human Description:
coiled-coil domain containing 113 [Source:HGNC Symbol;Acc:25002]
Mouse Orthologue:
Ccdc113
Mouse Description:
coiled-coil domain containing 113 Gene [Source:MGI Symbol;Acc:MGI:3606076]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44254 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38025 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa44254
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008989 Essential Splice Site 63 358 2 8
Genomic Location (Zv9):
Chromosome 25 (position 14095042)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13566617
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGACGTTTGAAACAGTGTGGAAATGGCAGAATTTGTCAACGGAAAAGG[T/G]ACGTATTTGTGTTTAACGTTAATAAGATAAACAAGTGTGTACAGTTCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38025
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008989 Nonsense 172 358 5 8
Genomic Location (Zv9):
Chromosome 25 (position 14097417)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13568992
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTAAAAATCACAACGTAGTATCCAAATCTTTCCAGGACATTTTGATT[G/T]AGAAGTTGCACCGAAAAAATTCAGCACTCCTCACACACAAGAAAAAACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link