si:dkey-15i8.3

Ensembl ID:
ENSDARG00000006978
ZFIN ID:
ZDB-GENE-070912-386
Description:
Novel protein similar to vertebrate sterile alpha motif and leucine zipper containing kinase AZK (ZA
Human Orthologue:
AC013461.1
Human Description:
Mitogen-activated protein kinase kinase kinase MLT [Source:UniProtKB/Swiss-Prot;Acc:Q9NYL2]
Mouse Orthologue:
B230120H23Rik
Mouse Description:
RIKEN cDNA B230120H23 gene Gene [Source:MGI Symbol;Acc:MGI:2443258]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27328 Nonsense Mutation detected in F1 DNA During 2017
sa2499 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa27328
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102823 Nonsense 93 789 3 19
Genomic Location (Zv9):
Chromosome 9 (position 2926911)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 2922383
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTTTTATCGTAGAGTATGCCAGTGGCGGGTCTCTGTTTGACTA[T/A]CTGTCCAGCGACGACAGCGAGGACATCAGTATGCAGCAGATCATGACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2499
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102823 Nonsense 367 789 13 19
Genomic Location (Zv9):
Chromosome 9 (position 2908118)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 2903590
KASP Assay ID:
554-2917.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCTGCACAGGTGACGGAGAGCTGCAGCAGTACGCYAATGTCTTCAGA[C/T]AGAACCACATCACAGGACAGAGACTGCTGCTGCTGTCCGAGTCTGACATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link