cse1l

Ensembl ID:
ENSDARG00000006963
ZFIN ID:
ZDB-GENE-990603-1
Description:
Exportin-2 [Source:UniProtKB/Swiss-Prot;Acc:Q7SZC2]
Human Orthologue:
CSE1L
Human Description:
CSE1 chromosome segregation 1-like (yeast) [Source:HGNC Symbol;Acc:2431]
Mouse Orthologue:
Cse1l
Mouse Description:
chromosome segregation 1-like (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1339951]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35010 Splice Site, Nonsense Available for shipment Available now
sa7357 Missense Mutation detected in F1 DNA During 2016
sa35011 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35010
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013203 Splice Site, Nonsense 30 971 3 25

The following transcripts of ENSDARG00000006963 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 5556748)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5526204
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCATACCTGGTATTAAATGATAAAATGTTCTTATTGTCTTCATCAGCC[G/T]AGAAGTTTCTGGAGTCGGTGGAGGGAAACCAGAACTATCCCATTTTACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7357
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013203 Missense 656 971 18 25

The following transcripts of ENSDARG00000006963 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 5566438)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5535894
KASP Assay ID:
554-4313.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGAAGAAGCCCTGTTTCCTGTGTTTACAGAGATCCTCCAGAATGACG[T/A]GCAGGGTATGGTGCTGGTATAAAGTTCTTACACTCCTTCTTTCCTCTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35011
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013203 Essential Splice Site 865 971 24 25

The following transcripts of ENSDARG00000006963 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 5573428)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5542884
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGACCAAGAAAGAATAATAATATTATTTAATACTCTTTTATTTTTTAA[G/A]GGCTCCTTTGCTGCAGGCTCTGATTGGTTTATTTGAGTTGCCAGAAGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link