LOC567286

Ensembl ID:
ENSDARG00000006944
Human Orthologue:
GDPD3
Human Description:
glycerophosphodiester phosphodiesterase domain containing 3 [Source:HGNC Symbol;Acc:28638]
Mouse Orthologue:
Gdpd3
Mouse Description:
glycerophosphodiester phosphodiesterase domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1915866]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa495 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa495
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041082 Nonsense 138 316 5 10
Genomic Location:
Chromosome 12 (position 4578680)
KASP Assay ID:
554-0212.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTACAGCACAGGGAAGGACAGGAGGTTTGTGTTGCTGGAAAACGTCT[T/A]GAAGAATTTCCCCAACATGCCAATGACACTCGAGATCAAAGAAAACAACG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/skw8uoew