LOC799091

Ensembl ID:
ENSDARG00000006924
Human Orthologue:
FBXO38
Human Description:
F-box protein 38 [Source:HGNC Symbol;Acc:28844]
Mouse Orthologue:
Fbxo38
Mouse Description:
F-box protein 38 Gene [Source:MGI Symbol;Acc:MGI:2444639]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19091 Essential Splice Site Mutation detected in F1 DNA During 2016
sa39010 Essential Splice Site Mutation detected in F1 DNA During 2016
sa13849 Nonsense Available for shipment Available now
sa35737 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35738 Essential Splice Site Available for shipment Available now
sa11788 Nonsense Available for shipment Available now
sa16333 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19091
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020625 Essential Splice Site 322 1120 6 20
Genomic Location (Zv9):
Chromosome 14 (position 40055532)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 38325137
KASP Assay ID:
2260-7811.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCACTTGAAGTGGATCTGGGTTACCTCATCATTACTGCTGCTCGCAGG[T/C]AAGTCAGTTTAAAGAACATTATAAACGAAACATTTAGTTTGTTCAGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39010
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020625 Essential Splice Site 365 1120 7 20
Genomic Location (Zv9):
Chromosome 14 (position 40055740)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 38325345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGTTCGAGACTTTGCACCTTGGATATGTTGATGAGTTTCTGTTGCAAT[G/T]TAAGTCATTTTTATTGTATGTTTGAAAGATCACATTTTATCTTGAGACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13849
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020625 Nonsense 582 1120 11 20
Genomic Location (Zv9):
Chromosome 14 (position 40059662)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 38329267
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAGAGTTCCAGTCAGACTCCAAAYCCTTCKCTTGAACAGGATGAAGAA[C/T]AAGCTGGTCTGAAGAAATCAWATAAACACTCAAAAARTRACNNNNNNNNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35737
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020625 Essential Splice Site 640 1120 12 20
Genomic Location (Zv9):
Chromosome 14 (position 40060115)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 38329720
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGAGACAGAGGCCCAGGGCAAGAGCAGCACCGCTGGGACTCCACATGG[T/A]AATGAATGTTTAAAATCCTCATAATCAGAAATGGTTATTGCATACAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35738
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020625 Essential Splice Site 850 1120 14 20
Genomic Location (Zv9):
Chromosome 14 (position 40068228)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 38337833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATCCACCAGTACCAGTGACCCGGTGACTGAAGATGATCACGTGCAGG[T/C]GGGTTTGTAGTCTTCTCTCACTTATCTTGATGTTTCTTTAAAGGTTCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11788
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020625 Nonsense 994 1120 18 20
Genomic Location (Zv9):
Chromosome 14 (position 40072198)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 38341803
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCACCAAGCTGCTTTTTGTTTATCCTTTCACAAGAGAACTCATCAAGTA[T/A]GAATTCTTTCCGGAGGCCACACGAACGGAAGAGGATGTGAAGAAGTATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16333
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020625 Nonsense 1043 1120 19 20
Genomic Location (Zv9):
Chromosome 14 (position 40074812)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 38344417
KASP Assay ID:
2260-7815.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATGGGGCGCCGTATTCGATGATCACTGATTTCCCATGGCTTCGCTCTT[T/A]ACGCACAGCAGAGCCCAACACTTACGCTCGATACGACTTTGAAGATGATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link