cacna1ab

Ensembl ID:
ENSDARG00000006923
ZFIN ID:
ZDB-GENE-090514-3
Human Orthologue:
CACNA1A
Human Description:
calcium channel, voltage-dependent, P/Q type, alpha 1A subunit [Source:HGNC Symbol;Acc:1388]
Mouse Orthologue:
Cacna1a
Mouse Description:
calcium channel, voltage-dependent, P/Q type, alpha 1A subunit Gene [Source:MGI Symbol;Acc:MGI:10948

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12560 Essential Splice Site Available for shipment Available now
sa12516 Essential Splice Site Available for shipment Available now
sa35120 Nonsense Mutation detected in F1 DNA During 2016
sa15403 Essential Splice Site Available for shipment Available now
sa7292 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa5845 Essential Splice Site Mutation detected in F1 DNA During 2016
sa10764 Essential Splice Site Available for shipment Available now
sa35121 Nonsense Mutation detected in F1 DNA During 2016
sa9062 Nonsense Mutation detected in F1 DNA During 2016
sa41872 Nonsense Mutation detected in F1 DNA During 2016
sa41873 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12560
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008139 Essential Splice Site 38 2101 1 51
ENSDART00000008139 Essential Splice Site 38 2101 1 51
Genomic Location (Zv9):
Chromosome 11 (position 31781540)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30658902
KASP Assay ID:
2260-4470.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGCAGTCAGAGTRTTACGGCCGCTAAAACTGGTGTCAGGAATTCCTAG[T/C]AAGTTTTCCATCTGTGTCAGTTTTTTTCTGTCTTTTTTCCCCCAACATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12516
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008139 Essential Splice Site 38 2101 1 51
ENSDART00000008139 Essential Splice Site 38 2101 1 51
Genomic Location (Zv9):
Chromosome 11 (position 31781540)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30658902
KASP Assay ID:
2260-4470.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGCAGTCAGAGTRTTACGGCCGCTAAAACTGGTGTCAGGAATTCCTAG[T/C]AAGTTTTCCATCTGTGTCAGTTTTTTTCTGTCTTTTTTCCCCCAACATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35120
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008139 Nonsense 206 2101 5 51
Genomic Location (Zv9):
Chromosome 11 (position 31783731)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30661093
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGCGTGTAGAGAACAGGAGTGAGTTCCTCAAGCTCAAACGGCAGCAG[C/T]AGATCGAGAGAGAGCTCAACGGTTACCTGGAGTGGATCTGCAAAGCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15403
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008139 Essential Splice Site 340 2101 8 51
Genomic Location (Zv9):
Chromosome 11 (position 31785271)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30662633
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGCTGYAGTACACTACGATCAGCCTGAGCTACTGTCAGACTTCCTCTG[T/A]AAGTTCTGAYTCTTACTGAGTTGTTTGTTTTTACTTGCATGTTCAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7292
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008139 Splice Site, Nonsense 775 2101 19 51
Genomic Location (Zv9):
Chromosome 11 (position 31801777)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30679139
KASP Assay ID:
554-5368.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GYAATAAGAAGTCAGTGTTGCTTTGTTTTTTCTTTATTTTAACCCTTTCA[C/T]GTACAAGTTCTAAATCTTCAGCTGACCCCCCACCCCTGTGAGTTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5845
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008139 Essential Splice Site 962 2101 22 51
Genomic Location (Zv9):
Chromosome 11 (position 31806410)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30683772
KASP Assay ID:
554-3714.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCGTTAGCAGCAGAAGATCCCGTCTCACAGGATTCAGAGAGAAACAAAG[T/A]GAGCAAAAAGATTTTAAATATATGTTTACTGTCGTAAYTAATATTTATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10764
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008139 Essential Splice Site 983 2101 24 51
Genomic Location (Zv9):
Chromosome 11 (position 31808013)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30685375
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTYTGTGTGTGGTTTCGCCTCTTTGCTTTATTCCTCTGCTTTGTGTTTC[A/G]GATGGTGGTGTTAGGCTTGATTTTGCACGAGGGCTCATATTTTCGTGAYC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35121
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008139 Nonsense 1131 2101 27 51
Genomic Location (Zv9):
Chromosome 11 (position 31822427)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30699789
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGAGGTCAAATCTCAGAAGAGGGAGTGGAAGAAGTACGATTTCCACTA[C/A]GACAATGTGCTTTGGGCCCTGCTTACTCTCTTTACTGTGTCCACCGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9062
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008139 Nonsense 1246 2101 29 51
Genomic Location (Zv9):
Chromosome 11 (position 31825675)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30703037
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAACCTCTAACGCGCCACATGCCTCAGAACAAGCAAAGCTTTCAGTAC[C/T]GAATGTGGCAGTTTGTGGTGTCGCCTCCGTTTGAGTACAGTATCATGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41872
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008139 Nonsense 1282 2101 30 51
Genomic Location (Zv9):
Chromosome 11 (position 31826477)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30703839
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTATTTTTTTAACTGTGTGTTTTCAGTATAATGGGGCTTCCGATGCATA[T/A]GACAAAGTCCTGAAGAACCTGAATATAGTGTTCACCACATTCTTCTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41873
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008139 Nonsense 1897 2101 47 51
Genomic Location (Zv9):
Chromosome 11 (position 31897105)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30774467
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACACAGTCGGGTGACCTCCCACCTAAAGAAAGGGAACGAGAACGGGGT[C/T]GAGCAAAAGACCGTCGCCACCACCACCACCATCATCACCACCACGGCTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link