cacna1ab

Ensembl ID:: ENSDARG00000006923
ZFIN ID:: ZDB-GENE-090514-3
Human Orthologue:: CACNA1A
Human Description:: calcium channel, voltage-dependent, P/Q type, alpha 1A subunit [Source:HGNC Symbol;Acc:1388]
Mouse Orthologue:: Cacna1a
Mouse Description:: calcium channel, voltage-dependent, P/Q type, alpha 1A subunit Gene [Source:MGI Symbol;Acc:MGI:10948

Alleles

There are 9 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa12560	Essential Splice Site	Available for shipment	Available now
sa12516	Essential Splice Site	Available for shipment	Available now
sa15403	Essential Splice Site	Available for shipment	Available now
sa7292	Splice Site, Nonsense	Mutation detected in F1 DNA	During 2015
sa5845	Essential Splice Site	Mutation detected in F1 DNA	During 2015
sa10764	Essential Splice Site	Available for shipment	Available now
sa9062	Nonsense	Mutation detected in F1 DNA	During 2015
sa19009	Nonsense	Mutation detected in F1 DNA	During 2015
sa4424	Nonsense	Confirmed mutation in F2 line	During 2015

Mutation Details

Allele Name:: sa12560
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: T > C
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000008139	Essential Splice Site	38	2101	1	51
ENSDART00000008139	Essential Splice Site	38	2101	1	51

Genomic Location:: Chromosome 11 (position 31781540)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: CGAGCAGTCAGAGTRTTACGGCCGCTAAAACTGGTGTCAGGAATTCCTAG[T/C]AAGTTTTCCATCTGTGTCAGTTTTTTTCTGTCTTTTTTCCCCCAACATGC
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa12516
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: T > C
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000008139	Essential Splice Site	38	2101	1	51
ENSDART00000008139	Essential Splice Site	38	2101	1	51

Genomic Location:: Chromosome 11 (position 31781540)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: CGAGCAGTCAGAGTRTTACGGCCGCTAAAACTGGTGTCAGGAATTCCTAG[T/C]AAGTTTTCCATCTGTGTCAGTTTTTTTCTGTCTTTTTTCCCCCAACATGC
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa15403
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: T > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000008139	Essential Splice Site	340	2101	8	51

Genomic Location:: Chromosome 11 (position 31785271)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: GTGGCTGYAGTACACTACGATCAGCCTGAGCTACTGTCAGACTTCCTCTG[T/A]AAGTTCTGAYTCTTACTGAGTTGTTTGTTTTTACTTGCATGTTCAAAAAT
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa7292
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: C > T
Consequence:: Splice Site, Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000008139	Splice Site, Nonsense	775	2101	19	51

Genomic Location:: Chromosome 11 (position 31801777)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: GYAATAAGAAGTCAGTGTTGCTTTGTTTTTTCTTTATTTTAACCCTTTCA[C/T]GTACAAGTTCTAAATCTTCAGCTGACCCCCCACCCCTGTGAGTTTTTTTT
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa5845
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: T > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000008139	Essential Splice Site	962	2101	22	51

Genomic Location:: Chromosome 11 (position 31806410)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: CGCGTTAGCAGCAGAAGATCCCGTCTCACAGGATTCAGAGAGAAACAAAG[T/A]GAGCAAAAAGATTTTAAATATATGTTTACTGTCGTAAYTAATATTTATGC
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa10764
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: A > G
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000008139	Essential Splice Site	983	2101	24	51

Genomic Location:: Chromosome 11 (position 31808013)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: TTTYTGTGTGTGGTTTCGCCTCTTTGCTTTATTCCTCTGCTTTGTGTTTC[A/G]GATGGTGGTGTTAGGCTTGATTTTGCACGAGGGCTCATATTTTCGTGAYC
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa9062
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000008139	Nonsense	1246	2101	29	51

Genomic Location:: Chromosome 11 (position 31825675)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: CCAAACCTCTAACGCGCCACATGCCTCAGAACAAGCAAAGCTTTCAGTAC[C/T]GAATGTGGCAGTTTGTGGTGTCGCCTCCGTTTGAGTACAGTATCATGTCT
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa19009
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: C > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000008139	Nonsense	1517	2101	36	51
ENSDART00000008139	Nonsense	1517	2101	36	51

Genomic Location:: Chromosome 11 (position 31838840)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: None
Flanking Sequence:: ATCCTGGGTCCGCATCATTTGGATGAGTATGTCAGGATATGGGCAGAGTA[C/A]GACCCCGCAGCCTGGTGAGTGGCACTTTCCTCACACACACATTTTAAAAA
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa4424
Current Status:: Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: C > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000008139	Nonsense	1517	2101	36	51
ENSDART00000008139	Nonsense	1517	2101	36	51

Genomic Location:

Chromosome 11 (position 31838840)

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

ATCCTGGGTCCGCATCATTTGGATGAGTATGTCAGGATATGGGCAGAGTA[C/A]GACCCCGCAGCCTGGTGAGTGGCACTTTCCTCACACACACATTTTAAAAR

Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage	Entity	Quality	Tag
Larval:Day 5 ZFS:0000037	swim bladder ZFA:0000076	aplastic PATO:0001483	abnormal PATO:0000460

OMIM

More OMIM information for CACNA1A

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: