cacna1ab
- Ensembl ID:
- ENSDARG00000006923
- ZFIN ID:
- ZDB-GENE-090514-3
- Human Orthologue:
- CACNA1A
- Human Description:
- calcium channel, voltage-dependent, P/Q type, alpha 1A subunit [Source:HGNC Symbol;Acc:1388]
- Mouse Orthologue:
- Cacna1a
- Mouse Description:
- calcium channel, voltage-dependent, P/Q type, alpha 1A subunit Gene [Source:MGI Symbol;Acc:MGI:10948
Alleles
There are 11 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa12560 |
Essential Splice Site |
Available for shipment |
Available now |
sa12516 |
Essential Splice Site |
Available for shipment |
Available now |
sa35120 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa15403 |
Essential Splice Site |
Available for shipment |
Available now |
sa7292 |
Splice Site, Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa5845 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa10764 |
Essential Splice Site |
Available for shipment |
Available now |
sa35121 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa9062 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa41872 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa41873 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa12560
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000008139 |
Essential Splice Site |
38 |
2101 |
1 |
51 |
ENSDART00000008139 |
Essential Splice Site |
38 |
2101 |
1 |
51 |
- Genomic Location (Zv9):
- Chromosome 11 (position 31781540)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
30658902 |
GRCz11 |
11 |
30906086 |
- KASP Assay ID:
- 2260-4470.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CGAGCAGTCAGAGTRTTACGGCCGCTAAAACTGGTGTCAGGAATTCCTAG[T/C]AAGTTTTCCATCTGTGTCAGTTTTTTTCTGTCTTTTTTCCCCCAACATGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12516
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000008139 |
Essential Splice Site |
38 |
2101 |
1 |
51 |
ENSDART00000008139 |
Essential Splice Site |
38 |
2101 |
1 |
51 |
- Genomic Location (Zv9):
- Chromosome 11 (position 31781540)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
30658902 |
GRCz11 |
11 |
30906086 |
- KASP Assay ID:
- 2260-4470.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CGAGCAGTCAGAGTRTTACGGCCGCTAAAACTGGTGTCAGGAATTCCTAG[T/C]AAGTTTTCCATCTGTGTCAGTTTTTTTCTGTCTTTTTTCCCCCAACATGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35120
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000008139 |
Nonsense |
206 |
2101 |
5 |
51 |
- Genomic Location (Zv9):
- Chromosome 11 (position 31783731)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
30661093 |
GRCz11 |
11 |
30908277 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGAGCGTGTAGAGAACAGGAGTGAGTTCCTCAAGCTCAAACGGCAGCAG[C/T]AGATCGAGAGAGAGCTCAACGGTTACCTGGAGTGGATCTGCAAAGCAGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15403
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000008139 |
Essential Splice Site |
340 |
2101 |
8 |
51 |
- Genomic Location (Zv9):
- Chromosome 11 (position 31785271)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
30662633 |
GRCz11 |
11 |
30909817 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GTGGCTGYAGTACACTACGATCAGCCTGAGCTACTGTCAGACTTCCTCTG[T/A]AAGTTCTGAYTCTTACTGAGTTGTTTGTTTTTACTTGCATGTTCAAAAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7292
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Splice Site, Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000008139 |
Splice Site, Nonsense |
775 |
2101 |
19 |
51 |
- Genomic Location (Zv9):
- Chromosome 11 (position 31801777)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
30679139 |
GRCz11 |
11 |
30926323 |
- KASP Assay ID:
- 554-5368.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GYAATAAGAAGTCAGTGTTGCTTTGTTTTTTCTTTATTTTAACCCTTTCA[C/T]GTACAAGTTCTAAATCTTCAGCTGACCCCCCACCCCTGTGAGTTTTTTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa5845
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000008139 |
Essential Splice Site |
962 |
2101 |
22 |
51 |
- Genomic Location (Zv9):
- Chromosome 11 (position 31806410)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
30683772 |
GRCz11 |
11 |
30930956 |
- KASP Assay ID:
- 554-3714.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CGCGTTAGCAGCAGAAGATCCCGTCTCACAGGATTCAGAGAGAAACAAAG[T/A]GAGCAAAAAGATTTTAAATATATGTTTACTGTCGTAAYTAATATTTATGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10764
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000008139 |
Essential Splice Site |
983 |
2101 |
24 |
51 |
- Genomic Location (Zv9):
- Chromosome 11 (position 31808013)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
30685375 |
GRCz11 |
11 |
30932559 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TTTYTGTGTGTGGTTTCGCCTCTTTGCTTTATTCCTCTGCTTTGTGTTTC[A/G]GATGGTGGTGTTAGGCTTGATTTTGCACGAGGGCTCATATTTTCGTGAYC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35121
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000008139 |
Nonsense |
1131 |
2101 |
27 |
51 |
- Genomic Location (Zv9):
- Chromosome 11 (position 31822427)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
30699789 |
GRCz11 |
11 |
30946973 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACGAGGTCAAATCTCAGAAGAGGGAGTGGAAGAAGTACGATTTCCACTA[C/A]GACAATGTGCTTTGGGCCCTGCTTACTCTCTTTACTGTGTCCACCGGAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9062
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000008139 |
Nonsense |
1246 |
2101 |
29 |
51 |
- Genomic Location (Zv9):
- Chromosome 11 (position 31825675)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
30703037 |
GRCz11 |
11 |
30950221 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CCAAACCTCTAACGCGCCACATGCCTCAGAACAAGCAAAGCTTTCAGTAC[C/T]GAATGTGGCAGTTTGTGGTGTCGCCTCCGTTTGAGTACAGTATCATGTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41872
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000008139 |
Nonsense |
1282 |
2101 |
30 |
51 |
- Genomic Location (Zv9):
- Chromosome 11 (position 31826477)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
30703839 |
GRCz11 |
11 |
30951023 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTATTTTTTTAACTGTGTGTTTTCAGTATAATGGGGCTTCCGATGCATA[T/A]GACAAAGTCCTGAAGAACCTGAATATAGTGTTCACCACATTCTTCTTCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41873
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000008139 |
Nonsense |
1897 |
2101 |
47 |
51 |
- Genomic Location (Zv9):
- Chromosome 11 (position 31897105)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
30774467 |
GRCz11 |
11 |
31021651 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTACACAGTCGGGTGACCTCCCACCTAAAGAAAGGGAACGAGAACGGGGT[C/T]GAGCAAAAGACCGTCGCCACCACCACCACCATCATCACCACCACGGCTCG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: