cacna1ab

Ensembl ID:
ENSDARG00000006923
ZFIN ID:
ZDB-GENE-090514-3
Human Orthologue:
CACNA1A
Human Description:
calcium channel, voltage-dependent, P/Q type, alpha 1A subunit [Source:HGNC Symbol;Acc:1388]
Mouse Orthologue:
Cacna1a
Mouse Description:
calcium channel, voltage-dependent, P/Q type, alpha 1A subunit Gene [Source:MGI Symbol;Acc:MGI:10948

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12560 Essential Splice Site Available for shipment Available now
sa12516 Essential Splice Site Available for shipment Available now
sa15403 Essential Splice Site Available for shipment Available now
sa7292 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa5845 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10764 Essential Splice Site Available for shipment Available now
sa9062 Nonsense Mutation detected in F1 DNA During 2014
sa19009 Nonsense Mutation detected in F1 DNA During 2014
sa4424 Nonsense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa12560
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008139 Essential Splice Site 38 2101 1 51
ENSDART00000008139 Essential Splice Site 38 2101 1 51
Genomic Location:
Chromosome 11 (position 31781540)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGCAGTCAGAGTRTTACGGCCGCTAAAACTGGTGTCAGGAATTCCTAG[T/C]AAGTTTTCCATCTGTGTCAGTTTTTTTCTGTCTTTTTTCCCCCAACATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12516
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008139 Essential Splice Site 38 2101 1 51
ENSDART00000008139 Essential Splice Site 38 2101 1 51
Genomic Location:
Chromosome 11 (position 31781540)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGCAGTCAGAGTRTTACGGCCGCTAAAACTGGTGTCAGGAATTCCTAG[T/C]AAGTTTTCCATCTGTGTCAGTTTTTTTCTGTCTTTTTTCCCCCAACATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15403
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008139 Essential Splice Site 340 2101 8 51
Genomic Location:
Chromosome 11 (position 31785271)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGCTGYAGTACACTACGATCAGCCTGAGCTACTGTCAGACTTCCTCTG[T/A]AAGTTCTGAYTCTTACTGAGTTGTTTGTTTTTACTTGCATGTTCAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7292
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008139 Splice Site, Nonsense 775 2101 19 51
Genomic Location:
Chromosome 11 (position 31801777)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GYAATAAGAAGTCAGTGTTGCTTTGTTTTTTCTTTATTTTAACCCTTTCA[C/T]GTACAAGTTCTAAATCTTCAGCTGACCCCCCACCCCTGTGAGTTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5845
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008139 Essential Splice Site 962 2101 22 51
Genomic Location:
Chromosome 11 (position 31806410)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCGTTAGCAGCAGAAGATCCCGTCTCACAGGATTCAGAGAGAAACAAAG[T/A]GAGCAAAAAGATTTTAAATATATGTTTACTGTCGTAAYTAATATTTATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10764
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008139 Essential Splice Site 983 2101 24 51
Genomic Location:
Chromosome 11 (position 31808013)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTYTGTGTGTGGTTTCGCCTCTTTGCTTTATTCCTCTGCTTTGTGTTTC[A/G]GATGGTGGTGTTAGGCTTGATTTTGCACGAGGGCTCATATTTTCGTGAYC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9062
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008139 Nonsense 1246 2101 29 51
Genomic Location:
Chromosome 11 (position 31825675)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAACCTCTAACGCGCCACATGCCTCAGAACAAGCAAAGCTTTCAGTAC[C/T]GAATGTGGCAGTTTGTGGTGTCGCCTCCGTTTGAGTACAGTATCATGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19009
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008139 Nonsense 1517 2101 36 51
ENSDART00000008139 Nonsense 1517 2101 36 51
Genomic Location:
Chromosome 11 (position 31838840)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCTGGGTCCGCATCATTTGGATGAGTATGTCAGGATATGGGCAGAGTA[C/A]GACCCCGCAGCCTGGTGAGTGGCACTTTCCTCACACACACATTTTAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4424
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008139 Nonsense 1517 2101 36 51
ENSDART00000008139 Nonsense 1517 2101 36 51
Genomic Location:
Chromosome 11 (position 31838840)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCTGGGTCCGCATCATTTGGATGAGTATGTCAGGATATGGGCAGAGTA[C/A]GACCCCGCAGCCTGGTGAGTGGCACTTTCCTCACACACACATTTTAAAAR
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
swim bladder
ZFA:0000076
aplastic
PATO:0001483
abnormal
PATO:0000460

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ak7k8vdx