lrp5

Ensembl ID:
ENSDARG00000006921
ZFIN ID:
ZDB-GENE-050518-2
Description:
low-density lipoprotein receptor-related protein 5 [Source:RefSeq peptide;Acc:NP_001170929]
Human Orthologues:
LRP5, LRP5L
Human Descriptions:
low density lipoprotein receptor-related protein 5 [Source:HGNC Symbol;Acc:6697]
low density lipoprotein receptor-related protein 5-like [Source:HGNC Symbol;Acc:25323]
Mouse Orthologue:
Lrp5
Mouse Description:
low density lipoprotein receptor-related protein 5 Gene [Source:MGI Symbol;Acc:MGI:1278315]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11097 Nonsense Available for shipment Available now
sa13599 Nonsense Available for shipment Available now
sa14611 Nonsense Available for shipment Available now
sa24618 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11097
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121724 Nonsense 284 1615 5 24
Genomic Location:
Chromosome 25 (position 10931525)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAACAAACACAGCGGAGAGAAGCACAGGGAAATTCTCAACGGCATTTA[C/A]TCGCCGATGGACATCCAGGTGCTTGGCCAAGAGCGCCAGCCCAACAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13599
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121724 Nonsense 347 1615 7 24
Genomic Location:
Chromosome 25 (position 10922018)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCACTATTGTTCTCTGAGCAAATCTCTATTTTTTTCCTAGGAGCAGAA[C/T]AGGTGCTTTTACTTGCTCGTCGCAYYGATCTTCGGCGGATATCCTTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14611
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121724 Nonsense 406 1615 7 24
Genomic Location:
Chromosome 25 (position 10921841)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGATATGTCTACTGGACGGACGATGAGTTGAGGGCTATACGGCGTGCT[C/T]GAATTGATGGAAGCGATGCCCAGACTTTAATCACCAATGAGATCAATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24618
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121724 Essential Splice Site 1529 1615 24 24
Genomic Location:
Chromosome 25 (position 10858417)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACAGCTAAGTATTTTTTCAGCTTTTACTGACCCAATATTCCCCTCTTT[A/C]GACCATATCTGATGCGAGGGGTCGCGCCCCCCACCACCCCCTGCAGCACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a5wrobmy