lrp5

Ensembl ID:
ENSDARG00000006921
ZFIN ID:
ZDB-GENE-050518-2
Description:
low-density lipoprotein receptor-related protein 5 [Source:RefSeq peptide;Acc:NP_001170929]
Human Orthologues:
LRP5, LRP5L
Human Descriptions:
low density lipoprotein receptor-related protein 5 [Source:HGNC Symbol;Acc:6697]
low density lipoprotein receptor-related protein 5-like [Source:HGNC Symbol;Acc:25323]
Mouse Orthologue:
Lrp5
Mouse Description:
low density lipoprotein receptor-related protein 5 Gene [Source:MGI Symbol;Acc:MGI:1278315]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11097 Nonsense Available for shipment Available now
sa13599 Nonsense Available for shipment Available now
sa14611 Nonsense Available for shipment Available now
sa32520 Nonsense Available for shipment Available now
sa24618 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11097
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121724 Nonsense 284 1615 5 24
Genomic Location (Zv9):
Chromosome 25 (position 10931525)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10622150
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAACAAACACAGCGGAGAGAAGCACAGGGAAATTCTCAACGGCATTTA[C/A]TCGCCGATGGACATCCAGGTGCTTGGCCAAGAGCGCCAGCCCAACAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13599
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121724 Nonsense 347 1615 7 24
Genomic Location (Zv9):
Chromosome 25 (position 10922018)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10612643
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCACTATTGTTCTCTGAGCAAATCTCTATTTTTTTCCTAGGAGCAGAA[C/T]AGGTGCTTTTACTTGCTCGTCGCAYYGATCTTCGGCGGATATCCTTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14611
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121724 Nonsense 406 1615 7 24
Genomic Location (Zv9):
Chromosome 25 (position 10921841)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10612466
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGATATGTCTACTGGACGGACGATGAGTTGAGGGCTATACGGCGTGCT[C/T]GAATTGATGGAAGCGATGCCCAGACTTTAATCACCAATGAGATCAATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32520
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121724 Nonsense 932 1615 13 24
Genomic Location (Zv9):
Chromosome 25 (position 10881300)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10573260
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGCCAGTGTGCCCACCTGTGTCTGGCATCCCCCTCTGGAGCCCAGTGT[C/T]GATGCGCGTCTCACTACACCCTGGAGGCCAACGGACGCAACTGCAGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24618
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121724 Essential Splice Site 1529 1615 24 24
Genomic Location (Zv9):
Chromosome 25 (position 10858417)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10550368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACAGCTAAGTATTTTTTCAGCTTTTACTGACCCAATATTCCCCTCTTT[A/C]GACCATATCTGATGCGAGGGGTCGCGCCCCCCACCACCCCCTGCAGCACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link