si:ch1073-459j12.1

Ensembl ID:
ENSDARG00000006901
ZFIN ID:
ZDB-GENE-030131-8546
Description:
Novel protein similat to H.sapiens AEBP1, AE binding protein 1 (AEBP1) [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
AEBP1
Human Description:
AE binding protein 1 [Source:HGNC Symbol;Acc:303]
Mouse Orthologue:
Aebp1
Mouse Description:
AE binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1197012]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21368 Nonsense Available for shipment Available now
sa34478 Nonsense Mutation detected in F1 DNA During 2017
sa10660 Essential Splice Site Available for shipment Available now
sa18929 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31673 Nonsense Available for shipment Available now
sa34477 Nonsense Available for shipment Available now
sa34476 Nonsense Available for shipment Available now
sa31672 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21368
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025875   None 842 None 12
ENSDART00000114912 Nonsense 68 351 2 8
ENSDART00000132115 Nonsense 68 1247 2 22
Genomic Location (Zv9):
Chromosome 8 (position 46771664)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44775418
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTTTAGATCTTCTGCAAGTGAAAATAATTCCACCCTATGCAACGATC[G/T]AAGTTGGACAACACAAACAATTGCTCTGCAAAGGTGAGATGCCAGTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34478
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025875   None 842 None 12
ENSDART00000114912 Nonsense 74 351 2 8
ENSDART00000132115 Nonsense 74 1247 2 22
Genomic Location (Zv9):
Chromosome 8 (position 46771646)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44775436
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGAAAATAATTCCACCCTATGCAACGATCGAAGTTGGACAACACAAA[C/T]AATTGCTCTGCAAAGGTGAGATGCCAGTTAAAATATTAAAGAATTTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10660
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025875 Essential Splice Site 106 842 3 12
ENSDART00000114912   None 351 None 8
ENSDART00000132115 Essential Splice Site 511 1247 13 22
Genomic Location (Zv9):
Chromosome 8 (position 46750959)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44796123
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAATGATAGCAGAGAGTGGACTTTYCTTCATGATGGRTATGCTGAATGG[G/A]TAGGTTGCCAGATTAGAGACCACAATCATTTTTNCTCCATATCTATTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18929
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025875 Essential Splice Site 184 842 5 12
ENSDART00000114912   None 351 None 8
ENSDART00000132115 Essential Splice Site 589 1247 15 22
Genomic Location (Zv9):
Chromosome 8 (position 46746194)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44800888
KASP Assay ID:
2260-1041.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCGAGATAACCTGGACTACACCCATCACAACTACCTAGACATGGAGAAG[G/T]TGATGGAAAGCAGCATGAAGTCTCAAGAGTTCATAAGTGGCCAAAAGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31673
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025875 Nonsense 236 842 7 12
ENSDART00000114912   None 351 None 8
ENSDART00000132115 Nonsense 641 1247 17 22
Genomic Location (Zv9):
Chromosome 8 (position 46745710)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44801372
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTAATATGTTTCCTCAGGAGAGCCAGAATTCAGGTACACAGCTGGCTA[T/G]CATGGTAATGAGGCTTTGGGACGAGAGCTGCTTCTAATGTTCATGCAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34477
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025875 Nonsense 254 842 7 12
ENSDART00000114912   None 351 None 8
ENSDART00000132115 Nonsense 659 1247 17 22
Genomic Location (Zv9):
Chromosome 8 (position 46745657)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44801425
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTAATGAGGCTTTGGGACGAGAGCTGCTTCTAATGTTCATGCAGTATT[T/A]GTGTAAAGAATATAAAGATGGCAACCCTCGAGTTCGCCACCTAGTGGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34476
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025875 Nonsense 333 842 8 12
ENSDART00000114912   None 351 None 8
ENSDART00000132115 Nonsense 738 1247 18 22
Genomic Location (Zv9):
Chromosome 8 (position 46743771)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44803311
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTAAATAACATTTATTGGGATTCAGAGGATAAAGGCATGGTGCCCAAAT[T/A]GACACCAAATCACCATATTCCCATTCCTGAGGGTATTCTCTCAAGCAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31672
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025875 Nonsense 398 842 9 12
ENSDART00000114912   None 351 None 8
ENSDART00000132115 Nonsense 803 1247 19 22
Genomic Location (Zv9):
Chromosome 8 (position 46743460)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44803622
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACATACCCGTTTGACATGCGCCGTCTAACCAAAGAGTCTGAGGCTATG[G/T]AGAAAAAACTTGGCTCCAGAGCAAACCGACGTAAGCGACAGTATGAGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link