si:ch1073-459j12.1
- Ensembl ID:
- ENSDARG00000006901
- ZFIN ID:
- ZDB-GENE-030131-8546
- Description:
- Novel protein similat to H.sapiens AEBP1, AE binding protein 1 (AEBP1) [Source:UniProtKB/TrEMBL;Acc:
- Human Orthologue:
- AEBP1
- Human Description:
- AE binding protein 1 [Source:HGNC Symbol;Acc:303]
- Mouse Orthologue:
- Aebp1
- Mouse Description:
- AE binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1197012]
Alleles
There are 9 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa45334 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa21368 |
Nonsense |
Available for shipment |
Available now |
sa34478 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa10660 |
Essential Splice Site |
Available for shipment |
Available now |
sa18929 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa31673 |
Nonsense |
Available for shipment |
Available now |
sa34477 |
Nonsense |
Available for shipment |
Available now |
sa34476 |
Nonsense |
Available for shipment |
Available now |
sa31672 |
Nonsense |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa45334
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 46771674)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
44775408 |
GRCz11 |
8 |
44769314 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATTGTTTGTTTCTTTTAGATCTTCTGCAAGTGAAAATAATTCCACCCTA[T/A]GCAACGATCGAAGTTGGACAACACAAACAATTGCTCTGCAAAGGTGAGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21368
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 46771664)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
44775418 |
GRCz11 |
8 |
44769324 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCTTTTAGATCTTCTGCAAGTGAAAATAATTCCACCCTATGCAACGATC[G/T]AAGTTGGACAACACAAACAATTGCTCTGCAAAGGTGAGATGCCAGTTAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34478
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 46771646)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
44775436 |
GRCz11 |
8 |
44769342 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGTGAAAATAATTCCACCCTATGCAACGATCGAAGTTGGACAACACAAA[C/T]AATTGCTCTGCAAAGGTGAGATGCCAGTTAAAATATTAAAGAATTTAATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10660
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 8 (position 46750959)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
44796123 |
GRCz11 |
8 |
44790029 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GTAATGATAGCAGAGAGTGGACTTTYCTTCATGATGGRTATGCTGAATGG[G/A]TAGGTTGCCAGATTAGAGACCACAATCATTTTTNCTCCATATCTATTTTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18929
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 8 (position 46746194)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
44800888 |
GRCz11 |
8 |
44794794 |
- KASP Assay ID:
- 2260-1041.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTCGAGATAACCTGGACTACACCCATCACAACTACCTAGACATGGAGAAG[G/T]TGATGGAAAGCAGCATGAAGTCTCAAGAGTTCATAAGTGGCCAAAAGGGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31673
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 46745710)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
44801372 |
GRCz11 |
8 |
44795278 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATTAATATGTTTCCTCAGGAGAGCCAGAATTCAGGTACACAGCTGGCTA[T/G]CATGGTAATGAGGCTTTGGGACGAGAGCTGCTTCTAATGTTCATGCAGTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34477
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 46745657)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
44801425 |
GRCz11 |
8 |
44795331 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGTAATGAGGCTTTGGGACGAGAGCTGCTTCTAATGTTCATGCAGTATT[T/A]GTGTAAAGAATATAAAGATGGCAACCCTCGAGTTCGCCACCTAGTGGATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34476
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 46743771)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
44803311 |
GRCz11 |
8 |
44797217 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTAAATAACATTTATTGGGATTCAGAGGATAAAGGCATGGTGCCCAAAT[T/A]GACACCAAATCACCATATTCCCATTCCTGAGGGTATTCTCTCAAGCAATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31672
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 46743460)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
44803622 |
GRCz11 |
8 |
44797528 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGACATACCCGTTTGACATGCGCCGTCTAACCAAAGAGTCTGAGGCTATG[G/T]AGAAAAAACTTGGCTCCAGAGCAAACCGACGTAAGCGACAGTATGAGGAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: