impdh2

Ensembl ID:
ENSDARG00000006900
ZFIN ID:
ZDB-GENE-030114-5
Description:
inosine-5'-monophosphate dehydrogenase 2 [Source:RefSeq peptide;Acc:NP_958872]
Human Orthologue:
IMPDH2
Human Description:
IMP (inosine 5'-monophosphate) dehydrogenase 2 [Source:HGNC Symbol;Acc:6053]
Mouse Orthologue:
Impdh2
Mouse Description:
inosine 5'-phosphate dehydrogenase 2 Gene [Source:MGI Symbol;Acc:MGI:109367]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41221 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41221
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009178 Nonsense 58 514 3 14
Genomic Location (Zv9):
Chromosome 8 (position 26914522)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26042440
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTTGTTAATGCTTTCATTCGTAGGACCTGACATCAGCCCTGACCAAA[C/T]AAATCACAATGAAAACCCCACTGATCTCGTCGCCTATGGATACAGTCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link