far1

Ensembl ID:
ENSDARG00000006899
ZFIN ID:
ZDB-GENE-040426-2908
Description:
fatty acyl CoA reductase 1 [Source:RefSeq peptide;Acc:NP_998673]
Human Orthologue:
FAR1
Human Description:
fatty acyl CoA reductase 1 [Source:HGNC Symbol;Acc:26222]
Mouse Orthologue:
Far1
Mouse Description:
fatty acyl CoA reductase 1 Gene [Source:MGI Symbol;Acc:MGI:1914670]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13327 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13327
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061753 Essential Splice Site None 432 1 11
ENSDART00000139778 None None 197 None 4
ENSDART00000142564 None None 181 None 3
ENSDART00000146350 Essential Splice Site None 464 1 11
ENSDART00000146604 None None 197 None 4
Genomic Location:
Chromosome 25 (position 16437367)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGACCGACACGCAAAAAATAGTGCGGGGAAAATATATTCAACATCCAAG[G/A]TAAGCGTACGTGTGCTTCGCGATTGTATCTGAGGTTACCTCCNTTTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2i1kjy3m