lhx6

Ensembl ID:
ENSDARG00000006896
ZFIN ID:
ZDB-GENE-041025-1
Description:
LIM/homeobox protein Lhx6 [Source:RefSeq peptide;Acc:NP_001004015]
Human Orthologue:
LHX6
Human Description:
LIM homeobox 6 [Source:HGNC Symbol;Acc:21735]
Mouse Orthologue:
Lhx6
Mouse Description:
LIM homeobox protein 6 Gene [Source:MGI Symbol;Acc:MGI:1306803]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34853 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34853
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021100 Essential Splice Site 112 375 4 9
Genomic Location (Zv9):
Chromosome 10 (position 9466580)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9542536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTATTATTATTATTATTAATTTTCACATACGCTATAATGTTTGTTTC[A/T]GGTTAATAATCTGATCTGGCACGTGAGGTGTCTGGAATGTTCCGTCTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link