oprk1

Ensembl ID:
ENSDARG00000006894
ZFIN ID:
ZDB-GENE-030729-1
Description:
kappa-type opioid receptor [Source:RefSeq peptide;Acc:NP_878306]
Human Orthologue:
OPRK1
Human Description:
opioid receptor, kappa 1 [Source:HGNC Symbol;Acc:8154]
Mouse Orthologue:
Oprk1
Mouse Description:
opioid receptor, kappa 1 Gene [Source:MGI Symbol;Acc:MGI:97439]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17794 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17794
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009326 Nonsense 324 377 4 4
Genomic Location:
Chromosome 2 (position 30601018)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGYGTGGCRTTGGGGTACACCAACAGCAGCCTGAACCCCATTCTGTA[C/A]GCCTTCCTTGATGAGAACTTCAAGCGCTGCTTTAGGGACTTYTGCTGCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tsaib34u