enpp4

Ensembl ID:
ENSDARG00000006877
ZFIN IDs:
ZDB-GENE-050417-444, ZDB-GENE-050417-444
Description:
Ectonucleotide pyrophosphatase/phosphodiesterase family member 4 [Source:UniProtKB/Swiss-Prot;Acc:Q5
Human Orthologue:
ENPP4
Human Description:
ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) [Source:HGNC Symbol;Acc:3359]
Mouse Orthologue:
Enpp4
Mouse Description:
ectonucleotide pyrophosphatase/phosphodiesterase 4 Gene [Source:MGI Symbol;Acc:MGI:2682634]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15858 Nonsense Available for shipment Available now
sa42855 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15858
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004043 Nonsense 6 459 2 4
ENSDART00000081883 Nonsense 6 459 1 3
Genomic Location (Zv9):
Chromosome 17 (position 5348816)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 5449470
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGAAAGYGAGTGCCACGTGTTCGCCACAGGATGCAGATCAGCGCTTA[T/A]CTCTGCGCTCTCATCGCCTGTTGTGGATTAACTCTATCTGCGCCGACCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42855
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004043 Nonsense 279 459 2 4
ENSDART00000081883 Nonsense 279 459 1 3
Genomic Location (Zv9):
Chromosome 17 (position 5347999)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 5448653
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCTACACACTGGTTGATCTCACTCCTGTGGCTGCTATTATACCACTG[G/T]AAGGTACTGCTTTCATTATTTATGGGGCTGTTGAGTGCTTGAATCTGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link