enpp4

Ensembl ID:
ENSDARG00000006877
ZFIN IDs:
ZDB-GENE-050417-444, ZDB-GENE-050417-444
Description:
Ectonucleotide pyrophosphatase/phosphodiesterase family member 4 [Source:UniProtKB/Swiss-Prot;Acc:Q5
Human Orthologue:
ENPP4
Human Description:
ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) [Source:HGNC Symbol;Acc:3359]
Mouse Orthologue:
Enpp4
Mouse Description:
ectonucleotide pyrophosphatase/phosphodiesterase 4 Gene [Source:MGI Symbol;Acc:MGI:2682634]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15858 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15858
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004043 Nonsense 6 459 2 4
ENSDART00000081883 Nonsense 6 459 1 3
Genomic Location:
Chromosome 17 (position 5348816)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGAAAGYGAGTGCCACGTGTTCGCCACAGGATGCAGATCAGCGCTTA[T/A]CTCTGCGCTCTCATCGCCTGTTGTGGATTAACTCTATCTGCGCCGACCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/783bkdl0