glra4a

Ensembl ID:
ENSDARG00000006865
ZFIN ID:
ZDB-GENE-010410-3
Description:
glycine receptor subunit alpha-4 [Source:RefSeq peptide;Acc:NP_571857]
Human Orthologue:
GLRA4
Human Description:
glycine receptor, alpha 4 [Source:HGNC Symbol;Acc:31715]
Mouse Orthologue:
Glra4
Mouse Description:
glycine receptor, alpha 4 subunit Gene [Source:MGI Symbol;Acc:MGI:95750]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13968 Nonsense Available for shipment Available now
sa3898 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13968
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026194 Nonsense 20 456 1 9
ENSDART00000030509 None None 457 None 9
ENSDART00000146445 None None 435 None 8

The following transcripts of ENSDARG00000006865 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 40526986)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTCTCTCATTATYACTGACTGTATCAATTGTTCATTTTSTCWTGTTTA[T/A]TTTTYTGGCTTCTTTTCTATATCCCTTCCTCTCTGCTTTCTCTATCTYTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3898
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026194 Essential Splice Site 89 456 3 9
ENSDART00000030509 Essential Splice Site 90 457 3 9
ENSDART00000146445 Essential Splice Site 68 435 2 8

The following transcripts of ENSDARG00000006865 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 40524987)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTAACATCTTCATCAACAGTTTTGGATCTATTACTGAGACAACAATG[G/A]TATGTCCGCCAACCTGATTTCACCAAGTAGGACATGTTCCTGGATTAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tptd3wti