si:ch1073-349o24.2

Ensembl ID:
ENSDARG00000006863
ZFIN ID:
ZDB-GENE-081104-83
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8K0F2]
Human Orthologue:
CCDC108
Human Description:
coiled-coil domain containing 108 [Source:HGNC Symbol;Acc:25325]
Mouse Orthologue:
Ccdc108
Mouse Description:
coiled-coil domain containing 108 Gene [Source:MGI Symbol;Acc:MGI:2444274]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34557 Essential Splice Site Mutation detected in F1 DNA During 2017
sa34558 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41356 Nonsense Mutation detected in F1 DNA During 2017
sa11573 Nonsense Available for shipment Available now
sa12787 Essential Splice Site Available for shipment Available now
sa8772 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13581 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34557
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041802 Essential Splice Site 25 1780 1 32
ENSDART00000145853 Essential Splice Site 25 1595 2 30
Genomic Location (Zv9):
Chromosome 9 (position 7775033)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7755126
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGAGCTCGCGAATCCCCTTTGGAGTCCCAAACAACCCACACAGAAAG[G/A]TAAGGAATGTAAAGTCATTATTATTTACCAGAGTAAACTTTGCCCGGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34558
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041802 Essential Splice Site 172 1780 4 32
ENSDART00000145853 Essential Splice Site 172 1595 5 30
Genomic Location (Zv9):
Chromosome 9 (position 7777649)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7757742
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCTGCTCAACAATGCTCTCAAACCAGCTTCTTCTTTAGGAATTCCAGG[T/C]AAAGATGTATTGGATGGTTGATTATACAGCTGCCATCTAAAGAAATGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41356
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041802 Nonsense 439 1780 8 32
ENSDART00000145853 Nonsense 437 1595 9 30
Genomic Location (Zv9):
Chromosome 9 (position 7783920)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7764013
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAAATTCAGACCACACTGTTCTGTAGCTTATCATAAGACTGTGACCTG[T/A]TTGCTGATGCACAGGGTAGGTTGGTTTATCAATCAATGTACCATTAATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11573
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041802 Nonsense 588 1780 10 32
ENSDART00000145853 Nonsense 586 1595 11 30
Genomic Location (Zv9):
Chromosome 9 (position 7785746)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7765839
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTCAGTCTCCATCACCAACCACACCARGGGCAAAATCTGTGTGATGTG[G/A]TCACCTGGRGCCAAATCCYCTTTCTCCATYTTTCCTCTCTCCTKTGAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12787
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041802 Essential Splice Site 683 1780 11 32
ENSDART00000145853 Essential Splice Site 681 1595 12 30
Genomic Location (Zv9):
Chromosome 9 (position 7789190)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7769283
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAAAGAGCCCTTTGTCCCCRAATTCTCTCTTCAACACTCTCAAGTGG[T/A]AAGTTAAATAAGGCACCTTTCATCATAATATGTTGAAAAAAATATAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8772
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041802 Essential Splice Site 1556 1780 28 32
ENSDART00000145853 Essential Splice Site 1554 1595 29 30
Genomic Location (Zv9):
Chromosome 9 (position 7806834)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7786927
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTACCAGACACATTTCCCTACTCACTTCAACACTCATTACATTWACAG[G/A]TACAAYAAGATGTCAAAATCAGGKRTGGMATTRAAAATTCTTGATATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13581
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041802 Essential Splice Site 1598 1780 None 32
ENSDART00000145853   1596 1595 None 30
Genomic Location (Zv9):
Chromosome 9 (position 7808674)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7788767
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGTCATGAGAGAGACATCGTMACRCATCTGCTCACCTCTTTGCTACAG[T/C]AAGTCTTTGAATTTTMMCCACTAGAGGGTGTGTATTCACAACAAAACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link