kifap3

Ensembl ID:
ENSDARG00000006862
ZFIN ID:
ZDB-GENE-030131-2219
Description:
kinesin-associated protein 3 [Source:RefSeq peptide;Acc:NP_001137517]
Human Orthologue:
KIFAP3
Human Description:
kinesin-associated protein 3 [Source:HGNC Symbol;Acc:17060]
Mouse Orthologue:
Kifap3
Mouse Description:
kinesin-associated protein 3 Gene [Source:MGI Symbol;Acc:MGI:107566]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9250 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9250
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026800 Nonsense 685 772 18 20

The following transcripts of ENSDARG00000006862 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 22732357)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23619062
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGGAAGAAGATCCAAAGCGAGAAGTTTCGCTGGCATAACTCGCAGTGGT[T/A]GGAGATGGTGGAGAGCAGACAGATGGAGGACGGCGAGCCCTACATGTATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link