accn1

Ensembl ID:
ENSDARG00000006849
ZFIN ID:
ZDB-GENE-040513-4
Human Orthologue:
ACCN1
Human Description:
amiloride-sensitive cation channel 1, neuronal [Source:HGNC Symbol;Acc:99]
Mouse Orthologue:
Accn1
Mouse Description:
amiloride-sensitive cation channel 1, neuronal (degenerin) Gene [Source:MGI Symbol;Acc:MGI:1100867]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40123 Nonsense Mutation detected in F1 DNA During 2016
sa6906 Nonsense Mutation detected in F1 DNA During 2016
sa31347 Nonsense Mutation detected in F1 DNA During 2016
sa1891 Nonsense F2 line generated During 2016
sa18762 Nonsense Mutation detected in F1 DNA During 2016
sa11288 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40123
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084803 Nonsense 70 564 1 10
ENSDART00000137038   None 271 None 7
Genomic Location (Zv9):
Chromosome 3 (position 38349386)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 38212746
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGAACACCACGAGACGATCTGTCCCGCCTCACCGTGGCCCTCCTCTCA[C/T]GAACTCGCCTCCATGGATTGCGGCATATCTGCTCTCCATCAAACTCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6906
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084803 Nonsense 106 564 1 10
ENSDART00000137038   None 271 None 7
Genomic Location (Zv9):
Chromosome 3 (position 38349496)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 38212856
KASP Assay ID:
554-5321.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTTTTGGATGATAGCATTCTGTACTTGTCTGGGTCTTCTKTTGTCTTG[G/A]TCCTCAAATCGGTTACTTCACTGGCTGGCCTTCCCCACTCACACGMGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31347
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084803 Nonsense 246 564 2 10
ENSDART00000137038 Nonsense 9 271 1 7
Genomic Location (Zv9):
Chromosome 3 (position 38500417)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 38363777
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCTTTTTCTTCTTGGTTTCAGGTGTTTACCCGTTACGGGAAATGCTA[C/A]ATGTTTAACGCTGCCGAAGAGGGGAAGACTTTGAGGACTACAATGAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1891
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084803 Nonsense 445 564 6 10
ENSDART00000137038 Nonsense 208 271 5 7
Genomic Location (Zv9):
Chromosome 3 (position 38603607)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 38466967
KASP Assay ID:
554-1881.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAGATCCCCAGTAAAACATCTGCACGCTACCTGGAGAAGAAGTTCAAC[C/T]GATCCGAGAAATATATCACGTGAGTGTTAAAAGCCTTTTTCCTCTCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18762
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084803 Nonsense 543 564 10 10
ENSDART00000137038   None 271 None 7
ENSDART00000084803 Nonsense 543 564 10 10
ENSDART00000137038   None 271 None 7
Genomic Location (Zv9):
Chromosome 3 (position 38619539)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 38482899
KASP Assay ID:
2259-3865.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTATTTCTCTTAGAGTACCTGTGATCCAGTAGTGAACCATTCAGAAT[C/A]GATAAGCCACACTGTCAGTGTTCCCCTTCAGACAACACTGGGCACCCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11288
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084803 Nonsense 543 564 10 10
ENSDART00000137038   None 271 None 7
ENSDART00000084803 Nonsense 543 564 10 10
ENSDART00000137038   None 271 None 7
Genomic Location (Zv9):
Chromosome 3 (position 38619539)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 38482899
KASP Assay ID:
2259-3865.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTATTTCTCTTAGAGTACCTGTGATCCRGTAGTGAACCATTCAGAAT[C/A]GATAAGCCACACTGTCAGTGTTCCCCTTCAGACAACACTGGGCACCCTAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link