si:ch211-219a4.6

Ensembl ID:
ENSDARG00000006848
ZFIN ID:
ZDB-GENE-081104-179
Description:
Novel protein similar to vertebrate poly (ADP-ribose) polymerase family [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
PARP9
Human Description:
poly (ADP-ribose) polymerase family, member 9 [Source:HGNC Symbol;Acc:24118]
Mouse Orthologues:
Parp9, Zc3hav1
Mouse Descriptions:
poly (ADP-ribose) polymerase family, member 9 Gene [Source:MGI Symbol;Acc:MGI:1933117]
zinc finger CCCH type, antiviral 1 Gene [Source:MGI Symbol;Acc:MGI:1926031]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21485 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21485
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027212 Essential Splice Site 446 456 5 6
ENSDART00000090486 Essential Splice Site 446 840 3 8
Genomic Location (Zv9):
Chromosome 9 (position 24793674)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23949460
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGGATGTATACTTTGTTGTTTTTCCAAAAGACAATGACATGATGAAG[G/A]TGATTTGCTTATTATACTGGCTTTTTGGTGCCCAACATTCATTTTCTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link