gnmt

Ensembl ID:
ENSDARG00000006840
ZFIN ID:
ZDB-GENE-040227-1
Description:
glycine N-methyltransferase [Source:RefSeq peptide;Acc:NP_997981]
Human Orthologue:
GNMT
Human Description:
glycine N-methyltransferase [Source:HGNC Symbol;Acc:4415]
Mouse Orthologue:
Gnmt
Mouse Description:
glycine N-methyltransferase Gene [Source:MGI Symbol;Acc:MGI:1202304]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36525 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36525
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024379 Nonsense 263 294 6 6
Genomic Location (Zv9):
Chromosome 17 (position 49078113)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 48886121
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCCCATCGTGTGGAGAATTTTAAGGAGATATTAAAAGCAGCGTTTTGG[G/T]GAAAATGCGAGCACAATGTATATGCCGACTTCAAGCAATACACTGCAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link