mycn

Ensembl ID:
ENSDARG00000006837
ZFIN ID:
ZDB-GENE-020711-1
Description:
N-myc protein [Source:UniProtKB/Swiss-Prot;Acc:Q9PSJ0]
Human Orthologue:
MYCN
Human Description:
v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) [Source:HGNC Symbol;Acc
Mouse Orthologues:
Mycn, Mycs
Mouse Descriptions:
myc-like oncogene, s-myc protein Gene [Source:MGI Symbol;Acc:MGI:1332242]
v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) Gene [Source:MGI Symbol

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1804 Missense F2 line generated During 2014
sa13838 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1804
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024104 Missense 150 497 2 3
ENSDART00000112277 Missense 140 486 2 5
Genomic Location:
Chromosome 20 (position 33334433)
KASP Assay ID:
554-1796.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTACCGGGAGACGACATTTGGGGGGCGTCGGACGGGGACCTCTTTGGC[T/G]CCGTTTTGGATACTACGGACAATTCCATCATCATTCAGGACTGCATGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13838
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024104 Nonsense 340 497 3 3
ENSDART00000112277 Nonsense 329 486 5 5
Genomic Location:
Chromosome 20 (position 33336811)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCTCCGCAGGAACTCATTTTAAAGAGGACAGCAGCAGCCTCCATCCAC[C/T]AGCAGCAACATAACTACGCAGCCCCATCCCCTTACTYCGAACAGCAAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Wilms tumor: A genome-wide association study identifies susceptibility loci for Wilms tumor. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fm1wxbfb