cyr61l2

Ensembl ID:
ENSDARG00000006823
ZFIN ID:
ZDB-GENE-060404-5
Description:
cysteine-rich, angiogenic inducer, 61 [Source:RefSeq peptide;Acc:NP_001074456]
Human Orthologue:
CYR61
Human Description:
cysteine-rich, angiogenic inducer, 61 [Source:HGNC Symbol;Acc:2654]
Mouse Orthologue:
Cyr61
Mouse Description:
cysteine rich protein 61 Gene [Source:MGI Symbol;Acc:MGI:88613]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34520 Nonsense Mutation detected in F1 DNA During 2017
sa41310 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34520
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098226 Nonsense 14 373 1 6
ENSDART00000124857 Nonsense 14 373 1 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 55072027)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52633317
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTTGGAAATGCATTCTGGAAGAAATCAGAGGACGCGGACACACACTTG[G/A]GTTGTTTTGTTGTTCGTGGTTTGCTCTGCTGACGGAGAGGTGAGGAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41310
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098226 Nonsense 165 373 3 6
ENSDART00000124857 Nonsense 165 373 3 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 55066904)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52638440
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCACACTGCACCAATCCTCGGCTGGAGACGCCGACTGGGCACTGCTGC[C/T]AGCGCTGGGTGTGTGACAGCGACAACAGCATCAGAGAGGAGGAGCCGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link